Incidental Mutation 'R8097:Olfr33'
ID630242
Institutional Source Beutler Lab
Gene Symbol Olfr33
Ensembl Gene ENSMUSG00000066273
Gene Nameolfactory receptor 33
SynonymsMTPCR33, GA_x6K02T2PBJ9-5431102-5430146, MOR11-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R8097 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location102712151-102719070 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102713990 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 141 (V141A)
Ref Sequence ENSEMBL: ENSMUSP00000149588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084817] [ENSMUST00000094124] [ENSMUST00000216312]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084817
AA Change: V141A

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000081877
Gene: ENSMUSG00000066273
AA Change: V141A

DomainStartEndE-ValueType
Pfam:7tm_4 37 317 2.1e-117 PFAM
Pfam:7TM_GPCR_Srsx 41 211 7.5e-11 PFAM
Pfam:7tm_1 47 299 2.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094124
SMART Domains Protein: ENSMUSP00000091674
Gene: ENSMUSG00000070423

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 6.2e-117 PFAM
Pfam:7TM_GPCR_Srsx 37 308 2.4e-7 PFAM
Pfam:7tm_1 43 293 2.4e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216312
AA Change: V141A

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 G A 19: 43,816,955 M749I probably benign Het
Adcy8 A T 15: 64,871,862 probably null Het
Adgrb2 G A 4: 130,007,897 C438Y probably damaging Het
Amn1 G A 6: 149,169,355 probably benign Het
Atxn2 C T 5: 121,749,223 R319W probably damaging Het
Ccdc162 T C 10: 41,634,119 E830G probably benign Het
Ccdc71 T C 9: 108,463,552 V188A probably benign Het
Ceacam11 A T 7: 17,975,530 R218* probably null Het
Col18a1 A C 10: 77,112,508 L390R unknown Het
Cps1 A G 1: 67,228,270 N1399S probably benign Het
Ctnnal1 T C 4: 56,847,845 E98G probably damaging Het
Cyp1a2 T A 9: 57,679,553 probably null Het
Cyp2d11 C A 15: 82,390,380 probably null Het
Cyp2j7 G A 4: 96,215,410 T296I possibly damaging Het
Dcc C T 18: 71,679,502 G407D probably damaging Het
E330034G19Rik T C 14: 24,306,852 L217S unknown Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Eea1 A G 10: 96,026,654 K813E probably benign Het
Ell3 TCTCCTC TCTC 2: 121,439,456 probably benign Het
Etf1 T C 18: 34,931,644 D4G probably benign Het
F830045P16Rik T C 2: 129,463,585 T290A possibly damaging Het
Filip1 T C 9: 79,818,259 D1026G probably benign Het
Flad1 A T 3: 89,409,135 L40H probably damaging Het
Fpr3 C A 17: 17,970,792 N108K probably damaging Het
Galntl6 A G 8: 57,962,373 probably null Het
Gm30302 T A 13: 49,790,200 M1L probably benign Het
Hmgcll1 T C 9: 76,015,139 L22P probably benign Het
Iars2 C T 1: 185,329,389 probably benign Het
Ifna15 A T 4: 88,557,701 L182Q probably benign Het
Kcna6 A T 6: 126,738,612 V438E probably damaging Het
Kcnma1 T A 14: 23,330,964 D1012V probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Lama2 G A 10: 27,190,664 Q1074* probably null Het
Lhx9 T C 1: 138,838,351 Y242C probably damaging Het
Lrrc37a T A 11: 103,504,099 I167F probably benign Het
Lrrc49 T A 9: 60,615,048 T351S probably benign Het
Lrrc56 A G 7: 141,195,906 probably null Het
Mlh1 C A 9: 111,256,092 probably null Het
Msh4 C T 3: 153,877,908 probably null Het
Nav2 A G 7: 49,587,777 D1999G probably damaging Het
Ncapd2 A T 6: 125,168,982 I1272K possibly damaging Het
Neurl1a A G 19: 47,257,519 D530G probably damaging Het
Nid2 T C 14: 19,798,589 V1019A possibly damaging Het
Nlrp2 A T 7: 5,327,651 L582Q probably damaging Het
Olfr1046 A T 2: 86,217,666 F15I probably damaging Het
Olfr1226 A T 2: 89,193,632 I134N probably damaging Het
Olfr99 A T 17: 37,279,927 Y164* probably null Het
Pde6c G T 19: 38,161,966 E520* probably null Het
Pdzk1 C T 3: 96,850,240 T4I probably benign Het
Pxdn C T 12: 30,006,602 L1271F probably damaging Het
Rap1gap G T 4: 137,728,286 V667F probably benign Het
Recql A T 6: 142,374,911 I137N probably damaging Het
Ryr2 T C 13: 11,945,995 E19G probably damaging Het
Ryr3 T C 2: 112,670,270 probably null Het
Six1 A G 12: 73,043,750 S214P possibly damaging Het
Slc24a1 T C 9: 64,924,452 D1121G probably damaging Het
Slc30a6 T A 17: 74,412,698 C218S possibly damaging Het
Stab2 T C 10: 86,869,095 D1803G possibly damaging Het
Sult2a3 A T 7: 14,082,710 V181E possibly damaging Het
Ubc C T 5: 125,389,918 probably benign Het
Usp8 A G 2: 126,754,880 N870S probably benign Het
Vmn1r225 A G 17: 20,502,349 I17M possibly damaging Het
Vps13b T C 15: 35,709,346 I1813T probably benign Het
Wdr11 C T 7: 129,607,887 P473L probably damaging Het
Zcchc4 T A 5: 52,795,991 I114N probably benign Het
Zfp516 C A 18: 82,987,170 S733* probably null Het
Other mutations in Olfr33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02064:Olfr33 APN 7 102713601 missense probably damaging 1.00
IGL02349:Olfr33 APN 7 102714126 missense probably damaging 0.99
IGL02739:Olfr33 APN 7 102714314 missense possibly damaging 0.58
IGL03110:Olfr33 APN 7 102713883 missense probably damaging 1.00
IGL03014:Olfr33 UTSW 7 102713546 missense probably null 0.91
R0158:Olfr33 UTSW 7 102713955 missense probably benign 0.03
R1455:Olfr33 UTSW 7 102713998 nonsense probably null
R1996:Olfr33 UTSW 7 102713792 missense probably damaging 1.00
R2032:Olfr33 UTSW 7 102713876 missense probably benign 0.00
R2152:Olfr33 UTSW 7 102713581 missense probably benign 0.01
R4852:Olfr33 UTSW 7 102713543 missense probably damaging 0.99
R4965:Olfr33 UTSW 7 102713495 missense probably damaging 1.00
R5264:Olfr33 UTSW 7 102714351 missense probably benign 0.00
R5464:Olfr33 UTSW 7 102713682 missense probably benign
R6680:Olfr33 UTSW 7 102714315 missense possibly damaging 0.70
R7195:Olfr33 UTSW 7 102713666 missense possibly damaging 0.74
R7373:Olfr33 UTSW 7 102714099 missense possibly damaging 0.53
R7391:Olfr33 UTSW 7 102713982 missense probably benign 0.02
R7872:Olfr33 UTSW 7 102714182 missense probably benign 0.01
R7948:Olfr33 UTSW 7 102713688 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGACAGTAATGTCAGCACAGGC -3'
(R):5'- TTCTGTCCATGCTAGCCCTAAG -3'

Sequencing Primer
(F):5'- GGCCAGCTTCATGACATCAG -3'
(R):5'- GTCCATGCTAGCCCTAAGTGATG -3'
Posted On2020-06-30