Mutagenetix > Incidental Mutation

Incidental Mutation 'R8097:Filip1'

630248

Institutional Source

Beutler Lab

Gene Symbol

Filip1

Ensembl Gene

ENSMUSG00000034898

Gene Name

filamin A interacting protein 1

Synonyms

5730485H21Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.648) question?

Stock #

R8097 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

79815051-80012851 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 79818259 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1026 (D1026G)

Ref Sequence

ENSEMBL: ENSMUSP00000091329 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093811] [ENSMUST00000172973]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000093811
AA Change: D1026G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000091329
Gene: ENSMUSG00000034898
AA Change: D1026G

Domain	Start	End	E-Value	Type
Pfam:CortBP2	71	256	2.1e-64	PFAM
coiled coil region	258	540	N/A	INTRINSIC
low complexity region	545	564	N/A	INTRINSIC
low complexity region	579	592	N/A	INTRINSIC
coiled coil region	625	778	N/A	INTRINSIC
low complexity region	928	940	N/A	INTRINSIC
low complexity region	1126	1140	N/A	INTRINSIC
low complexity region	1168	1180	N/A	INTRINSIC
low complexity region	1198	1214	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000172973

SMART Domains

Protein: ENSMUSP00000134427
Gene: ENSMUSG00000034898

Domain	Start	End	E-Value	Type
Pfam:CortBP2	65	225	5.2e-74	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.4%
20x: 98.6%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a filamin A binding protein. The encoded protein promotes the degradation of filamin A and may regulate cortical neuron migration and dendritic spine morphology. Mice lacking a functional copy of this gene exhibit reduced dendritic spine length and altered excitatory signaling. [provided by RefSeq, Oct 2016]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc2	G	A	19: 43,816,955	M749I	probably benign	Het
Adcy8	A	T	15: 64,871,862		probably null	Het
Adgrb2	G	A	4: 130,007,897	C438Y	probably damaging	Het
Amn1	G	A	6: 149,169,355		probably benign	Het
Atxn2	C	T	5: 121,749,223	R319W	probably damaging	Het
Ccdc162	T	C	10: 41,634,119	E830G	probably benign	Het
Ccdc71	T	C	9: 108,463,552	V188A	probably benign	Het
Ceacam11	A	T	7: 17,975,530	R218*	probably null	Het
Col18a1	A	C	10: 77,112,508	L390R	unknown	Het
Cps1	A	G	1: 67,228,270	N1399S	probably benign	Het
Ctnnal1	T	C	4: 56,847,845	E98G	probably damaging	Het
Cyp1a2	T	A	9: 57,679,553		probably null	Het
Cyp2d11	C	A	15: 82,390,380		probably null	Het
Cyp2j7	G	A	4: 96,215,410	T296I	possibly damaging	Het
Dcc	C	T	18: 71,679,502	G407D	probably damaging	Het
E330034G19Rik	T	C	14: 24,306,852	L217S	unknown	Het
E430018J23Rik	C	T	7: 127,393,324	C38Y	probably null	Het
Eea1	A	G	10: 96,026,654	K813E	probably benign	Het
Ell3	TCTCCTC	TCTC	2: 121,439,456		probably benign	Het
Etf1	T	C	18: 34,931,644	D4G	probably benign	Het
F830045P16Rik	T	C	2: 129,463,585	T290A	possibly damaging	Het
Flad1	A	T	3: 89,409,135	L40H	probably damaging	Het
Fpr3	C	A	17: 17,970,792	N108K	probably damaging	Het
Galntl6	A	G	8: 57,962,373		probably null	Het
Gm30302	T	A	13: 49,790,200	M1L	probably benign	Het
Hmgcll1	T	C	9: 76,015,139	L22P	probably benign	Het
Iars2	C	T	1: 185,329,389		probably benign	Het
Ifna15	A	T	4: 88,557,701	L182Q	probably benign	Het
Kcna6	A	T	6: 126,738,612	V438E	probably damaging	Het
Kcnma1	T	A	14: 23,330,964	D1012V	probably damaging	Het
Kctd17	CAGCTGGAGGAGC	CAGC	15: 78,436,913		probably benign	Het
Lama2	G	A	10: 27,190,664	Q1074*	probably null	Het
Lhx9	T	C	1: 138,838,351	Y242C	probably damaging	Het
Lrrc37a	T	A	11: 103,504,099	I167F	probably benign	Het
Lrrc49	T	A	9: 60,615,048	T351S	probably benign	Het
Lrrc56	A	G	7: 141,195,906		probably null	Het
Mlh1	C	A	9: 111,256,092		probably null	Het
Msh4	C	T	3: 153,877,908		probably null	Het
Nav2	A	G	7: 49,587,777	D1999G	probably damaging	Het
Ncapd2	A	T	6: 125,168,982	I1272K	possibly damaging	Het
Neurl1a	A	G	19: 47,257,519	D530G	probably damaging	Het
Nid2	T	C	14: 19,798,589	V1019A	possibly damaging	Het
Nlrp2	A	T	7: 5,327,651	L582Q	probably damaging	Het
Olfr1046	A	T	2: 86,217,666	F15I	probably damaging	Het
Olfr1226	A	T	2: 89,193,632	I134N	probably damaging	Het
Olfr33	A	G	7: 102,713,990	V141A	possibly damaging	Het
Olfr99	A	T	17: 37,279,927	Y164*	probably null	Het
Pde6c	G	T	19: 38,161,966	E520*	probably null	Het
Pdzk1	C	T	3: 96,850,240	T4I	probably benign	Het
Pxdn	C	T	12: 30,006,602	L1271F	probably damaging	Het
Rap1gap	G	T	4: 137,728,286	V667F	probably benign	Het
Recql	A	T	6: 142,374,911	I137N	probably damaging	Het
Ryr2	T	C	13: 11,945,995	E19G	probably damaging	Het
Ryr3	T	C	2: 112,670,270		probably null	Het
Six1	A	G	12: 73,043,750	S214P	possibly damaging	Het
Slc24a1	T	C	9: 64,924,452	D1121G	probably damaging	Het
Slc30a6	T	A	17: 74,412,698	C218S	possibly damaging	Het
Stab2	T	C	10: 86,869,095	D1803G	possibly damaging	Het
Sult2a3	A	T	7: 14,082,710	V181E	possibly damaging	Het
Ubc	C	T	5: 125,389,918		probably benign	Het
Usp8	A	G	2: 126,754,880	N870S	probably benign	Het
Vmn1r225	A	G	17: 20,502,349	I17M	possibly damaging	Het
Vps13b	T	C	15: 35,709,346	I1813T	probably benign	Het
Wdr11	C	T	7: 129,607,887	P473L	probably damaging	Het
Zcchc4	T	A	5: 52,795,991	I114N	probably benign	Het
Zfp516	C	A	18: 82,987,170	S733*	probably null	Het

Other mutations in Filip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Filip1	APN	9	79817944	missense	probably damaging	1.00
IGL01101:Filip1	APN	9	79898246	missense	probably benign	0.44
IGL01301:Filip1	APN	9	79819180	missense	possibly damaging	0.93
IGL01887:Filip1	APN	9	79819617	missense	probably benign	0.42
IGL02119:Filip1	APN	9	79818266	missense	probably benign
IGL02285:Filip1	APN	9	79820126	missense	probably damaging	1.00
IGL02395:Filip1	APN	9	79898410	missense	probably benign	0.01
IGL03398:Filip1	APN	9	79818943	missense	probably benign	0.03
IGL03400:Filip1	APN	9	79820473	missense	probably benign	0.01
IGL03404:Filip1	APN	9	79818559	missense	probably damaging	0.99
ANU18:Filip1	UTSW	9	79819180	missense	possibly damaging	0.93
BB010:Filip1	UTSW	9	79820047	missense	possibly damaging	0.65
BB020:Filip1	UTSW	9	79820047	missense	possibly damaging	0.65
R0101:Filip1	UTSW	9	79819528	missense	probably benign	0.04
R0243:Filip1	UTSW	9	79819003	missense	probably damaging	0.98
R0244:Filip1	UTSW	9	79819462	missense	possibly damaging	0.87
R0371:Filip1	UTSW	9	79860091	missense	probably damaging	1.00
R0399:Filip1	UTSW	9	79818310	missense	possibly damaging	0.71
R0412:Filip1	UTSW	9	79820289	missense	possibly damaging	0.59
R0671:Filip1	UTSW	9	79819390	missense	probably damaging	1.00
R1314:Filip1	UTSW	9	79820566	missense	probably damaging	1.00
R1465:Filip1	UTSW	9	79898307	missense	probably benign	0.25
R1465:Filip1	UTSW	9	79898307	missense	probably benign	0.25
R1602:Filip1	UTSW	9	79820591	missense	probably damaging	0.99
R1801:Filip1	UTSW	9	79815846	missense	probably damaging	0.98
R1929:Filip1	UTSW	9	79819930	missense	probably damaging	1.00
R1983:Filip1	UTSW	9	79860092	missense	probably damaging	1.00
R2066:Filip1	UTSW	9	79820216	missense	probably damaging	1.00
R2128:Filip1	UTSW	9	79819330	missense	probably damaging	0.99
R2271:Filip1	UTSW	9	79819930	missense	probably damaging	1.00
R2411:Filip1	UTSW	9	79898433	missense	probably damaging	0.98
R3429:Filip1	UTSW	9	79853670	missense	probably damaging	1.00
R3430:Filip1	UTSW	9	79853670	missense	probably damaging	1.00
R3945:Filip1	UTSW	9	79818367	missense	probably benign	0.01
R4007:Filip1	UTSW	9	79818727	missense	possibly damaging	0.71
R4583:Filip1	UTSW	9	79815809	missense	possibly damaging	0.76
R4803:Filip1	UTSW	9	79820114	missense	probably benign	0.05
R4837:Filip1	UTSW	9	79819459	missense	probably damaging	0.98
R4910:Filip1	UTSW	9	79817932	missense	probably benign	0.00
R4929:Filip1	UTSW	9	79819747	missense	probably benign	0.07
R5387:Filip1	UTSW	9	79818274	missense	probably benign
R5581:Filip1	UTSW	9	79819760	missense	possibly damaging	0.95
R5808:Filip1	UTSW	9	79818701	missense	possibly damaging	0.67
R5891:Filip1	UTSW	9	79819860	missense	possibly damaging	0.69
R6166:Filip1	UTSW	9	79819454	missense	probably damaging	0.99
R6273:Filip1	UTSW	9	79815886	missense	probably benign	0.01
R6380:Filip1	UTSW	9	79819624	missense	probably damaging	0.99
R6385:Filip1	UTSW	9	79820531	missense	possibly damaging	0.68
R6614:Filip1	UTSW	9	79815839	missense	probably damaging	1.00
R6715:Filip1	UTSW	9	79818758	missense	probably benign	0.03
R7047:Filip1	UTSW	9	79853634	missense	probably damaging	0.98
R7126:Filip1	UTSW	9	79898295	missense	possibly damaging	0.88
R7144:Filip1	UTSW	9	79820213	missense	possibly damaging	0.65
R7218:Filip1	UTSW	9	79818074	missense	probably benign
R7404:Filip1	UTSW	9	79820098	missense	possibly damaging	0.94
R7702:Filip1	UTSW	9	79820649	missense	probably benign	0.20
R7866:Filip1	UTSW	9	79818943	missense	probably benign	0.03
R7933:Filip1	UTSW	9	79820047	missense	possibly damaging	0.65
R8012:Filip1	UTSW	9	79817959	missense	probably damaging	0.97
R8213:Filip1	UTSW	9	79818092	missense	probably benign	0.01
R8305:Filip1	UTSW	9	79820475	nonsense	probably null
R8798:Filip1	UTSW	9	79820090	missense	possibly damaging	0.94
R9184:Filip1	UTSW	9	79898260	missense	probably benign	0.03
R9322:Filip1	UTSW	9	79819732	missense	probably benign	0.01
R9334:Filip1	UTSW	9	79818457	missense	probably benign	0.32
R9353:Filip1	UTSW	9	79818341	missense	possibly damaging	0.67
R9541:Filip1	UTSW	9	79819853	nonsense	probably null
R9607:Filip1	UTSW	9	79819120	missense	probably damaging	1.00
X0054:Filip1	UTSW	9	79819535	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- ATAACTGGACTCACGCCTTC -3'
(R):5'- CCAATGTCATGTCGCAAAAGC -3'

Sequencing Primer
(F):5'- GACTCACGCCTTCCGCTG -3'
(R):5'- AAAAGTGCAGATCCTACTCTCGG -3'

Posted On

2020-06-30