Incidental Mutation 'R8097:Ccdc162'
ID630252
Institutional Source Beutler Lab
Gene Symbol Ccdc162
Ensembl Gene ENSMUSG00000075225
Gene Namecoiled-coil domain containing 162
Synonyms5033413D22Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R8097 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location41538846-41716634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41634119 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 830 (E830G)
Ref Sequence ENSEMBL: ENSMUSP00000140774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019955] [ENSMUST00000099932] [ENSMUST00000189488]
Predicted Effect probably benign
Transcript: ENSMUST00000019955
SMART Domains Protein: ENSMUSP00000019955
Gene: ENSMUSG00000075225

DomainStartEndE-ValueType
coiled coil region 1 37 N/A INTRINSIC
low complexity region 116 138 N/A INTRINSIC
coiled coil region 177 217 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099932
SMART Domains Protein: ENSMUSP00000097516
Gene: ENSMUSG00000075225

DomainStartEndE-ValueType
coiled coil region 327 366 N/A INTRINSIC
low complexity region 490 512 N/A INTRINSIC
coiled coil region 551 607 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189488
AA Change: E830G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000140774
Gene: ENSMUSG00000075225
AA Change: E830G

DomainStartEndE-ValueType
low complexity region 328 347 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 G A 19: 43,816,955 M749I probably benign Het
Adgrb2 G A 4: 130,007,897 C438Y probably damaging Het
Atxn2 C T 5: 121,749,223 R319W probably damaging Het
Ccdc71 T C 9: 108,463,552 V188A probably benign Het
Ceacam11 A T 7: 17,975,530 R218* probably null Het
Col18a1 A C 10: 77,112,508 L390R unknown Het
Cps1 A G 1: 67,228,270 N1399S probably benign Het
Ctnnal1 T C 4: 56,847,845 E98G probably damaging Het
Cyp2d11 C A 15: 82,390,380 probably null Het
Cyp2j7 G A 4: 96,215,410 T296I possibly damaging Het
Dcc C T 18: 71,679,502 G407D probably damaging Het
E330034G19Rik T C 14: 24,306,852 L217S unknown Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Eea1 A G 10: 96,026,654 K813E probably benign Het
Ell3 TCTCCTC TCTC 2: 121,439,456 probably benign Het
Etf1 T C 18: 34,931,644 D4G probably benign Het
F830045P16Rik T C 2: 129,463,585 T290A possibly damaging Het
Filip1 T C 9: 79,818,259 D1026G probably benign Het
Flad1 A T 3: 89,409,135 L40H probably damaging Het
Fpr3 C A 17: 17,970,792 N108K probably damaging Het
Gm30302 T A 13: 49,790,200 M1L probably benign Het
Hmgcll1 T C 9: 76,015,139 L22P probably benign Het
Iars2 C T 1: 185,329,389 probably benign Het
Ifna15 A T 4: 88,557,701 L182Q probably benign Het
Kcna6 A T 6: 126,738,612 V438E probably damaging Het
Kcnma1 T A 14: 23,330,964 D1012V probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Lama2 G A 10: 27,190,664 Q1074* probably null Het
Lhx9 T C 1: 138,838,351 Y242C probably damaging Het
Lrrc37a T A 11: 103,504,099 I167F probably benign Het
Lrrc56 A G 7: 141,195,906 probably null Het
Mlh1 C A 9: 111,256,092 probably null Het
Msh4 C T 3: 153,877,908 probably null Het
Nav2 A G 7: 49,587,777 D1999G probably damaging Het
Ncapd2 A T 6: 125,168,982 I1272K possibly damaging Het
Neurl1a A G 19: 47,257,519 D530G probably damaging Het
Nid2 T C 14: 19,798,589 V1019A possibly damaging Het
Nlrp2 A T 7: 5,327,651 L582Q probably damaging Het
Olfr1046 A T 2: 86,217,666 F15I probably damaging Het
Olfr1226 A T 2: 89,193,632 I134N probably damaging Het
Olfr33 A G 7: 102,713,990 V141A possibly damaging Het
Olfr99 A T 17: 37,279,927 Y164* probably null Het
Pde6c G T 19: 38,161,966 E520* probably null Het
Pdzk1 C T 3: 96,850,240 T4I probably benign Het
Pxdn C T 12: 30,006,602 L1271F probably damaging Het
Rap1gap G T 4: 137,728,286 V667F probably benign Het
Recql A T 6: 142,374,911 I137N probably damaging Het
Ryr2 T C 13: 11,945,995 E19G probably damaging Het
Six1 A G 12: 73,043,750 S214P possibly damaging Het
Slc24a1 T C 9: 64,924,452 D1121G probably damaging Het
Slc30a6 T A 17: 74,412,698 C218S possibly damaging Het
Stab2 T C 10: 86,869,095 D1803G possibly damaging Het
Sult2a3 A T 7: 14,082,710 V181E possibly damaging Het
Ubc C T 5: 125,389,918 probably benign Het
Usp8 A G 2: 126,754,880 N870S probably benign Het
Vmn1r225 A G 17: 20,502,349 I17M possibly damaging Het
Vps13b T C 15: 35,709,346 I1813T probably benign Het
Wdr11 C T 7: 129,607,887 P473L probably damaging Het
Zcchc4 T A 5: 52,795,991 I114N probably benign Het
Zfp516 C A 18: 82,987,170 S733* probably null Het
Other mutations in Ccdc162
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Ccdc162 APN 10 41581339 missense probably benign 0.01
IGL01366:Ccdc162 APN 10 41580306 missense possibly damaging 0.49
IGL01924:Ccdc162 APN 10 41569887 missense probably damaging 1.00
IGL02504:Ccdc162 APN 10 41552388 missense probably damaging 1.00
IGL02678:Ccdc162 APN 10 41561155 missense probably damaging 0.99
IGL02955:Ccdc162 APN 10 41561127 missense probably damaging 1.00
beeswax UTSW 10 41561226 missense possibly damaging 0.57
honeycomb UTSW 10 41644641 missense probably benign 0.35
FR4304:Ccdc162 UTSW 10 41556121 missense possibly damaging 0.49
R0432:Ccdc162 UTSW 10 41541860 missense probably benign 0.01
R0585:Ccdc162 UTSW 10 41586379 missense probably benign 0.03
R0645:Ccdc162 UTSW 10 41586411 splice site probably benign
R0731:Ccdc162 UTSW 10 41579143 missense probably damaging 1.00
R1426:Ccdc162 UTSW 10 41553182 missense possibly damaging 0.89
R1447:Ccdc162 UTSW 10 41580247 missense probably damaging 1.00
R1712:Ccdc162 UTSW 10 41539431 missense probably benign 0.35
R2138:Ccdc162 UTSW 10 41581297 missense probably benign 0.15
R2351:Ccdc162 UTSW 10 41555972 critical splice donor site probably null
R2394:Ccdc162 UTSW 10 41569898 missense probably damaging 1.00
R2431:Ccdc162 UTSW 10 41569845 missense probably benign
R2571:Ccdc162 UTSW 10 41552397 missense probably damaging 1.00
R2873:Ccdc162 UTSW 10 41655099 missense possibly damaging 0.68
R2926:Ccdc162 UTSW 10 41561207 start gained probably benign
R2999:Ccdc162 UTSW 10 41580290 missense probably benign 0.00
R3412:Ccdc162 UTSW 10 41539549 splice site probably benign
R3712:Ccdc162 UTSW 10 41587379 missense probably benign
R3736:Ccdc162 UTSW 10 41589568 intron probably null
R4112:Ccdc162 UTSW 10 41656328 missense possibly damaging 0.77
R4557:Ccdc162 UTSW 10 41587388 missense probably benign 0.01
R4580:Ccdc162 UTSW 10 41561140 missense probably benign 0.02
R4685:Ccdc162 UTSW 10 41681686 missense possibly damaging 0.89
R4837:Ccdc162 UTSW 10 41673867 missense probably benign 0.00
R5155:Ccdc162 UTSW 10 41553580 splice site probably null
R5155:Ccdc162 UTSW 10 41579151 missense probably damaging 1.00
R5645:Ccdc162 UTSW 10 41552356 missense probably benign 0.06
R5656:Ccdc162 UTSW 10 41569934 missense probably benign 0.26
R5682:Ccdc162 UTSW 10 41556803 nonsense probably null
R5808:Ccdc162 UTSW 10 41655504 missense possibly damaging 0.62
R5909:Ccdc162 UTSW 10 41561115 missense probably damaging 1.00
R6000:Ccdc162 UTSW 10 41561163 missense possibly damaging 0.75
R6057:Ccdc162 UTSW 10 41634041 missense possibly damaging 0.72
R6211:Ccdc162 UTSW 10 41630145 nonsense probably null
R6264:Ccdc162 UTSW 10 41694468 missense probably benign 0.31
R6329:Ccdc162 UTSW 10 41663151 missense possibly damaging 0.76
R6349:Ccdc162 UTSW 10 41694400 missense probably damaging 0.97
R6398:Ccdc162 UTSW 10 41627149 missense probably damaging 1.00
R6453:Ccdc162 UTSW 10 41550825 missense probably damaging 1.00
R6602:Ccdc162 UTSW 10 41615980 missense probably benign 0.00
R6627:Ccdc162 UTSW 10 41663185 missense probably damaging 1.00
R6722:Ccdc162 UTSW 10 41644641 missense probably benign 0.35
R6750:Ccdc162 UTSW 10 41561226 missense possibly damaging 0.57
R6968:Ccdc162 UTSW 10 41673844 missense possibly damaging 0.55
R6970:Ccdc162 UTSW 10 41615958 missense probably benign 0.03
R6989:Ccdc162 UTSW 10 41581353 missense probably damaging 0.99
R7008:Ccdc162 UTSW 10 41552415 missense probably damaging 1.00
R7135:Ccdc162 UTSW 10 41673859 missense probably benign 0.00
R7139:Ccdc162 UTSW 10 41666721 missense possibly damaging 0.49
R7224:Ccdc162 UTSW 10 41561191 missense probably damaging 1.00
R7230:Ccdc162 UTSW 10 41678813 missense probably damaging 1.00
R7256:Ccdc162 UTSW 10 41556001 missense probably damaging 0.99
R7261:Ccdc162 UTSW 10 41561140 missense probably benign 0.02
R7390:Ccdc162 UTSW 10 41634048 missense probably benign
R7712:Ccdc162 UTSW 10 41627227 missense possibly damaging 0.56
R7726:Ccdc162 UTSW 10 41553075 missense probably benign 0.00
R7754:Ccdc162 UTSW 10 41587375 missense probably damaging 1.00
R7764:Ccdc162 UTSW 10 41690113 missense possibly damaging 0.95
R8053:Ccdc162 UTSW 10 41644581 missense probably benign
R8088:Ccdc162 UTSW 10 41623414 missense possibly damaging 0.68
R8094:Ccdc162 UTSW 10 41612868 missense probably benign 0.02
Z1176:Ccdc162 UTSW 10 41553131 missense probably benign 0.00
Z1176:Ccdc162 UTSW 10 41605108 missense possibly damaging 0.84
Z1176:Ccdc162 UTSW 10 41654997 missense possibly damaging 0.84
Z1176:Ccdc162 UTSW 10 41690092 missense probably benign 0.00
Z1177:Ccdc162 UTSW 10 41683195 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGTCTCTTTGCCAAGGACC -3'
(R):5'- CCCTGTTATAGAAAGATCAGGACG -3'

Sequencing Primer
(F):5'- TTTGCCAAGGACCCAACTCTC -3'
(R):5'- ACGTGTAGGAGCAGTGATATTG -3'
Posted On2020-06-30