Incidental Mutation 'R8098:Adnp'
ID 630284
Institutional Source Beutler Lab
Gene Symbol Adnp
Ensembl Gene ENSMUSG00000051149
Gene Name activity-dependent neuroprotective protein
Synonyms
MMRRC Submission 067530-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8098 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 168022906-168049032 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 168024452 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 948 (T948A)
Ref Sequence ENSEMBL: ENSMUSP00000085316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057793] [ENSMUST00000088001] [ENSMUST00000138667]
AlphaFold Q9Z103
Predicted Effect probably benign
Transcript: ENSMUST00000057793
AA Change: T948A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000056809
Gene: ENSMUSG00000051149
AA Change: T948A

DomainStartEndE-ValueType
ZnF_C2H2 74 97 6.57e0 SMART
ZnF_C2H2 107 129 1.77e1 SMART
low complexity region 130 141 N/A INTRINSIC
ZnF_C2H2 165 188 1.29e1 SMART
ZnF_C2H2 221 244 1.4e1 SMART
low complexity region 423 437 N/A INTRINSIC
ZnF_C2H2 446 468 8.62e1 SMART
ZnF_C2H2 488 509 2.54e1 SMART
ZnF_C2H2 511 534 1.03e-2 SMART
low complexity region 582 596 N/A INTRINSIC
ZnF_C2H2 621 646 1.27e2 SMART
HOX 756 817 2.95e-6 SMART
low complexity region 957 970 N/A INTRINSIC
low complexity region 1012 1023 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088001
AA Change: T948A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000085316
Gene: ENSMUSG00000051149
AA Change: T948A

DomainStartEndE-ValueType
ZnF_C2H2 74 97 6.57e0 SMART
ZnF_C2H2 107 129 1.77e1 SMART
low complexity region 130 141 N/A INTRINSIC
ZnF_C2H2 165 188 1.29e1 SMART
ZnF_C2H2 221 244 1.4e1 SMART
low complexity region 423 437 N/A INTRINSIC
ZnF_C2H2 446 468 8.62e1 SMART
ZnF_C2H2 488 509 2.54e1 SMART
ZnF_C2H2 511 534 1.03e-2 SMART
low complexity region 582 596 N/A INTRINSIC
ZnF_C2H2 621 646 1.27e2 SMART
HOX 756 817 2.95e-6 SMART
low complexity region 957 970 N/A INTRINSIC
low complexity region 1012 1023 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138667
SMART Domains Protein: ENSMUSP00000139070
Gene: ENSMUSG00000093752

DomainStartEndE-ValueType
Pfam:Glyco_tranf_2_3 24 240 1.1e-13 PFAM
Pfam:Glyco_tranf_2_2 28 153 8.4e-10 PFAM
Pfam:Glycos_transf_2 28 199 3.8e-40 PFAM
Pfam:Glyco_transf_21 87 200 1.5e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139984
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175182
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a protein family characterized by nine zinc finger motifs followed by a homeobox domain. In vitro studies demonstrate that the encoded protein interacts with the brahma-related gene1-associated or hBRM factors (BAF) gene expression regulating complex, components of the protein translation machinery, and microtubule-associated proteins. This gene has been implicated in neuroprotection through various processes that include chromatin remodeling, splicing, cytoskeletal reorganization, and autophagy. Homozygous mutant knockout mice display embryonic lethality with defects in neural tube closure. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Developmental defects including the failure of the cranial neural tube to close lead to embryonic death between E8.5 and E9. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,384,618 (GRCm39) L449P probably damaging Het
Abca15 A G 7: 119,960,619 (GRCm39) S694G probably benign Het
Abcc6 A G 7: 45,646,089 (GRCm39) L800P probably damaging Het
Adam15 T A 3: 89,251,193 (GRCm39) D504V probably damaging Het
Akap11 T C 14: 78,750,362 (GRCm39) D675G Het
Atp13a3 A C 16: 30,173,115 (GRCm39) V254G possibly damaging Het
Atp1a1 A G 3: 101,489,365 (GRCm39) I749T probably damaging Het
B3glct T A 5: 149,673,965 (GRCm39) Y369* probably null Het
Bms1 C T 6: 118,361,219 (GRCm39) R1204H probably damaging Het
Btla T A 16: 45,064,612 (GRCm39) L188* probably null Het
Btn2a2 A G 13: 23,666,058 (GRCm39) V258A probably benign Het
C1ra G A 6: 124,494,684 (GRCm39) E316K probably benign Het
Cacna1g T C 11: 94,307,338 (GRCm39) H1782R probably benign Het
Calcoco1 T C 15: 102,624,759 (GRCm39) D172G probably benign Het
Ccdc192 A T 18: 57,800,403 (GRCm39) I185L probably benign Het
Ciart G A 3: 95,788,656 (GRCm39) P61L probably damaging Het
Ckap4 A G 10: 84,369,499 (GRCm39) S78P probably damaging Het
Col6a3 A T 1: 90,731,383 (GRCm39) D1623E probably benign Het
Col7a1 A G 9: 108,785,763 (GRCm39) T411A unknown Het
Cpt1a A C 19: 3,420,849 (GRCm39) I436L probably benign Het
Cyp2c23 T A 19: 44,004,242 (GRCm39) I173F probably benign Het
Dcun1d2 T C 8: 13,311,396 (GRCm39) T198A probably benign Het
Ddx50 A C 10: 62,460,922 (GRCm39) probably null Het
Depdc1b A G 13: 108,460,593 (GRCm39) T68A probably damaging Het
Dgkq G A 5: 108,800,334 (GRCm39) R546W probably damaging Het
Dmbt1 G A 7: 130,710,188 (GRCm39) W1493* probably null Het
Dnah17 A G 11: 117,941,193 (GRCm39) S3219P probably damaging Het
Egf T A 3: 129,484,486 (GRCm39) Y986F probably benign Het
Ell3 TCTCCTC TCTC 2: 121,269,937 (GRCm39) probably benign Het
Ep400 A T 5: 110,841,117 (GRCm39) M1805K unknown Het
Exoc3 A G 13: 74,320,271 (GRCm39) M730T probably benign Het
Fbxl13 T A 5: 21,825,716 (GRCm39) M129L probably benign Het
Fem1al A G 11: 29,774,450 (GRCm39) S336P possibly damaging Het
Gins4 T A 8: 23,727,037 (GRCm39) M19L probably benign Het
Gm3238 T C 10: 77,606,474 (GRCm39) N229S unknown Het
Gpd2 T A 2: 57,180,020 (GRCm39) V89D possibly damaging Het
Hectd4 G A 5: 121,459,461 (GRCm39) V777I possibly damaging Het
Hgf T A 5: 16,766,059 (GRCm39) V65E probably benign Het
Hnrnpdl A G 5: 100,185,779 (GRCm39) S169P probably benign Het
Igfbp3 T C 11: 7,160,104 (GRCm39) D183G possibly damaging Het
Il16 A G 7: 83,295,767 (GRCm39) V1134A probably damaging Het
Kcnn4 A G 7: 24,083,504 (GRCm39) D395G probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,321,113 (GRCm39) probably benign Het
Kif13a T C 13: 46,968,780 (GRCm39) N354S probably damaging Het
Lrp1 C T 10: 127,410,324 (GRCm39) R1474Q possibly damaging Het
Map3k9 T C 12: 81,780,888 (GRCm39) Q424R probably damaging Het
Mkx A C 18: 6,992,784 (GRCm39) S167A possibly damaging Het
Ms4a14 A G 19: 11,281,979 (GRCm39) F193S possibly damaging Het
Myo18a A T 11: 77,736,227 (GRCm39) D1508V probably damaging Het
Nek4 T A 14: 30,685,908 (GRCm39) N273K probably benign Het
Nipal3 A T 4: 135,179,709 (GRCm39) V403D possibly damaging Het
Nlrp6 G A 7: 140,503,168 (GRCm39) V425M probably damaging Het
Or13p4 A T 4: 118,547,406 (GRCm39) V81E possibly damaging Het
Or14j6 A G 17: 38,215,250 (GRCm39) D271G probably damaging Het
Or4c122 T A 2: 89,079,652 (GRCm39) M117L possibly damaging Het
Or9k2 T C 10: 129,998,916 (GRCm39) K93R probably benign Het
Otub1 A T 19: 7,181,794 (GRCm39) D27E probably damaging Het
Pcnx2 T C 8: 126,495,040 (GRCm39) D1607G probably damaging Het
Pde2a A G 7: 101,071,178 (GRCm39) Y16C probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Prph2 A T 17: 47,230,892 (GRCm39) M262L probably benign Het
Pxdn C T 12: 30,056,601 (GRCm39) L1271F probably damaging Het
Rnf10 A C 5: 115,389,438 (GRCm39) I243S probably damaging Het
Samd9l T C 6: 3,375,549 (GRCm39) I571V probably damaging Het
Scube1 C T 15: 83,543,289 (GRCm39) G183D probably damaging Het
Sidt2 A G 9: 45,857,028 (GRCm39) V426A probably benign Het
Slc20a1 T C 2: 129,051,041 (GRCm39) L566P probably damaging Het
Slc22a3 A G 17: 12,642,619 (GRCm39) probably null Het
Snx11 G T 11: 96,661,500 (GRCm39) S168R probably benign Het
Snx5 T C 2: 144,097,482 (GRCm39) N218D probably benign Het
Snx7 A T 3: 117,632,583 (GRCm39) D169E probably benign Het
Soat1 A G 1: 156,274,180 (GRCm39) L77P probably damaging Het
Sucnr1 T A 3: 59,994,162 (GRCm39) V230E probably damaging Het
Supv3l1 T C 10: 62,265,282 (GRCm39) K753E probably benign Het
Tango6 T G 8: 107,468,990 (GRCm39) L829V possibly damaging Het
Tek T C 4: 94,715,907 (GRCm39) V443A probably benign Het
Tet1 A T 10: 62,714,859 (GRCm39) L312Q probably damaging Het
Tgm1 A T 14: 55,947,991 (GRCm39) N269K probably damaging Het
Thrb A T 14: 18,008,645 (GRCm38) D168V probably damaging Het
Tk2 C T 8: 104,957,804 (GRCm39) V181I probably benign Het
Tm6sf2 T C 8: 70,526,972 (GRCm39) L47P probably damaging Het
Tmcc3 T A 10: 94,415,078 (GRCm39) M291K probably benign Het
Tnfrsf21 A G 17: 43,350,790 (GRCm39) E318G probably benign Het
Ttc7 T C 17: 87,641,756 (GRCm39) V451A probably benign Het
Ugt2b36 A T 5: 87,240,252 (GRCm39) D44E probably benign Het
Usp17la G T 7: 104,510,138 (GRCm39) V248L probably damaging Het
Utp20 A C 10: 88,588,810 (GRCm39) I2453S probably benign Het
Wdr91 A T 6: 34,863,817 (GRCm39) I566N possibly damaging Het
Zfp282 A G 6: 47,867,652 (GRCm39) D276G probably benign Het
Zfp764l1 C T 7: 126,992,496 (GRCm39) C38Y probably null Het
Zfp866 T C 8: 70,218,628 (GRCm39) K331E probably benign Het
Zkscan17 A T 11: 59,394,410 (GRCm39) W64R possibly damaging Het
Other mutations in Adnp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Adnp APN 2 168,024,482 (GRCm39) missense probably benign
IGL00500:Adnp APN 2 168,025,243 (GRCm39) missense possibly damaging 0.85
IGL01604:Adnp APN 2 168,026,258 (GRCm39) missense probably damaging 0.99
IGL01967:Adnp APN 2 168,025,339 (GRCm39) missense possibly damaging 0.85
IGL02470:Adnp APN 2 168,025,114 (GRCm39) missense probably damaging 0.99
C9142:Adnp UTSW 2 168,026,327 (GRCm39) missense probably damaging 0.99
R0893:Adnp UTSW 2 168,025,647 (GRCm39) missense possibly damaging 0.85
R1167:Adnp UTSW 2 168,026,420 (GRCm39) missense probably benign 0.11
R1182:Adnp UTSW 2 168,026,716 (GRCm39) missense possibly damaging 0.77
R1480:Adnp UTSW 2 168,025,454 (GRCm39) missense probably damaging 0.99
R1505:Adnp UTSW 2 168,025,661 (GRCm39) missense possibly damaging 0.93
R1906:Adnp UTSW 2 168,024,287 (GRCm39) missense probably benign
R3711:Adnp UTSW 2 168,026,743 (GRCm39) missense probably damaging 0.98
R3943:Adnp UTSW 2 168,026,980 (GRCm39) missense possibly damaging 0.92
R4440:Adnp UTSW 2 168,026,721 (GRCm39) missense possibly damaging 0.92
R4686:Adnp UTSW 2 168,024,309 (GRCm39) missense possibly damaging 0.78
R4916:Adnp UTSW 2 168,029,537 (GRCm39) missense possibly damaging 0.91
R5072:Adnp UTSW 2 168,024,921 (GRCm39) missense probably damaging 0.96
R5312:Adnp UTSW 2 168,026,108 (GRCm39) missense probably benign
R5393:Adnp UTSW 2 168,024,869 (GRCm39) missense possibly damaging 0.95
R5598:Adnp UTSW 2 168,025,645 (GRCm39) missense probably damaging 0.99
R6230:Adnp UTSW 2 168,024,452 (GRCm39) missense probably benign
R7165:Adnp UTSW 2 168,024,287 (GRCm39) missense probably benign 0.07
R7176:Adnp UTSW 2 168,024,578 (GRCm39) missense probably benign
R7238:Adnp UTSW 2 168,025,887 (GRCm39) missense probably damaging 1.00
R7254:Adnp UTSW 2 168,025,918 (GRCm39) missense probably damaging 0.99
R7581:Adnp UTSW 2 168,025,386 (GRCm39) missense probably damaging 0.96
R7676:Adnp UTSW 2 168,025,367 (GRCm39) nonsense probably null
R7863:Adnp UTSW 2 168,031,270 (GRCm39) missense possibly damaging 0.91
R8196:Adnp UTSW 2 168,025,092 (GRCm39) missense probably benign
R8970:Adnp UTSW 2 168,031,290 (GRCm39) missense possibly damaging 0.91
R9153:Adnp UTSW 2 168,026,580 (GRCm39) missense possibly damaging 0.96
R9154:Adnp UTSW 2 168,026,580 (GRCm39) missense possibly damaging 0.96
R9228:Adnp UTSW 2 168,026,798 (GRCm39) missense probably damaging 0.98
R9256:Adnp UTSW 2 168,025,945 (GRCm39) missense probably damaging 1.00
R9268:Adnp UTSW 2 168,031,233 (GRCm39) missense possibly damaging 0.86
R9434:Adnp UTSW 2 168,026,377 (GRCm39) missense probably damaging 0.99
R9517:Adnp UTSW 2 168,024,866 (GRCm39) missense possibly damaging 0.93
R9621:Adnp UTSW 2 168,024,663 (GRCm39) missense probably benign 0.22
R9669:Adnp UTSW 2 168,026,918 (GRCm39) missense possibly damaging 0.91
R9737:Adnp UTSW 2 168,026,918 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TTTGGCAGCTGGCTTACTGC -3'
(R):5'- AAGCGGGAGTCCTTTTGACC -3'

Sequencing Primer
(F):5'- TTCACTCTGGGAAGACTCATCAG -3'
(R):5'- GACCCTGTCTTTGAAGTTGAGCC -3'
Posted On 2020-06-30