Incidental Mutation 'R8098:Olfr1342'
ID630292
Institutional Source Beutler Lab
Gene Symbol Olfr1342
Ensembl Gene ENSMUSG00000043383
Gene Nameolfactory receptor 1342
SynonymsGA_x6K02T2QD9B-18856980-18857927, MOR258-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R8098 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location118687486-118692756 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 118690209 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 81 (V81E)
Ref Sequence ENSEMBL: ENSMUSP00000149966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060562] [ENSMUST00000216226]
Predicted Effect possibly damaging
Transcript: ENSMUST00000060562
AA Change: V81E

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000053925
Gene: ENSMUSG00000043383
AA Change: V81E

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
Pfam:7tm_4 34 311 1.5e-55 PFAM
Pfam:7TM_GPCR_Srsx 38 243 1.6e-5 PFAM
Pfam:7tm_1 44 293 4.2e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216226
AA Change: V81E

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik A T 18: 57,667,331 I185L probably benign Het
3425401B19Rik A G 14: 32,662,661 L449P probably damaging Het
4931440F15Rik A G 11: 29,824,450 S336P possibly damaging Het
Abca15 A G 7: 120,361,396 S694G probably benign Het
Abcc6 A G 7: 45,996,665 L800P probably damaging Het
Adam15 T A 3: 89,343,886 D504V probably damaging Het
Adnp T C 2: 168,182,532 T948A probably benign Het
Akap11 T C 14: 78,512,922 D675G Het
Atp13a3 A C 16: 30,354,297 V254G possibly damaging Het
Atp1a1 A G 3: 101,582,049 I749T probably damaging Het
B3glct T A 5: 149,750,500 Y369* probably null Het
Bms1 C T 6: 118,384,258 R1204H probably damaging Het
Btla T A 16: 45,244,249 L188* probably null Het
Btn2a2 A G 13: 23,481,888 V258A probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Cacna1g T C 11: 94,416,512 H1782R probably benign Het
Calcoco1 T C 15: 102,716,324 D172G probably benign Het
Ciart G A 3: 95,881,344 P61L probably damaging Het
Ckap4 A G 10: 84,533,635 S78P probably damaging Het
Col6a3 A T 1: 90,803,661 D1623E probably benign Het
Col7a1 A G 9: 108,956,695 T411A unknown Het
Cpt1a A C 19: 3,370,849 I436L probably benign Het
Cyp2c23 T A 19: 44,015,803 I173F probably benign Het
Dcun1d2 T C 8: 13,261,396 T198A probably benign Het
Ddx50 A C 10: 62,625,143 probably null Het
Depdc1b A G 13: 108,324,059 T68A probably damaging Het
Dgkq G A 5: 108,652,468 R546W probably damaging Het
Dmbt1 G A 7: 131,108,459 W1493* probably null Het
Dnah17 A G 11: 118,050,367 S3219P probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Egf T A 3: 129,690,837 Y986F probably benign Het
Ell3 TCTCCTC TCTC 2: 121,439,456 probably benign Het
Ep400 A T 5: 110,693,251 M1805K unknown Het
Exoc3 A G 13: 74,172,152 M730T probably benign Het
Fbxl13 T A 5: 21,620,718 M129L probably benign Het
Gins4 T A 8: 23,237,021 M19L probably benign Het
Gm3238 T C 10: 77,770,640 N229S unknown Het
Gpd2 T A 2: 57,290,008 V89D possibly damaging Het
Hectd4 G A 5: 121,321,398 V777I possibly damaging Het
Hgf T A 5: 16,561,061 V65E probably benign Het
Hnrnpdl A G 5: 100,037,920 S169P probably benign Het
Igfbp3 T C 11: 7,210,104 D183G possibly damaging Het
Il16 A G 7: 83,646,559 V1134A probably damaging Het
Kcnn4 A G 7: 24,384,079 D395G probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Kif13a T C 13: 46,815,304 N354S probably damaging Het
Lrp1 C T 10: 127,574,455 R1474Q possibly damaging Het
Map3k9 T C 12: 81,734,114 Q424R probably damaging Het
Mkx A C 18: 6,992,784 S167A possibly damaging Het
Ms4a14 A G 19: 11,304,615 F193S possibly damaging Het
Myo18a A T 11: 77,845,401 D1508V probably damaging Het
Nek4 T A 14: 30,963,951 N273K probably benign Het
Nipal3 A T 4: 135,452,398 V403D possibly damaging Het
Nlrp6 G A 7: 140,923,255 V425M probably damaging Het
Olfr1228 T A 2: 89,249,308 M117L possibly damaging Het
Olfr127 A G 17: 37,904,359 D271G probably damaging Het
Olfr825 T C 10: 130,163,047 K93R probably benign Het
Otub1 A T 19: 7,204,429 D27E probably damaging Het
Pcnx2 T C 8: 125,768,301 D1607G probably damaging Het
Pde2a A G 7: 101,421,971 Y16C probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Prph2 A T 17: 46,919,966 M262L probably benign Het
Pxdn C T 12: 30,006,602 L1271F probably damaging Het
Rnf10 A C 5: 115,251,379 I243S probably damaging Het
Samd9l T C 6: 3,375,549 I571V probably damaging Het
Scube1 C T 15: 83,659,088 G183D probably damaging Het
Sidt2 A G 9: 45,945,730 V426A probably benign Het
Slc20a1 T C 2: 129,209,121 L566P probably damaging Het
Slc22a3 A G 17: 12,423,732 probably null Het
Snx11 G T 11: 96,770,674 S168R probably benign Het
Snx5 T C 2: 144,255,562 N218D probably benign Het
Snx7 A T 3: 117,838,934 D169E probably benign Het
Soat1 A G 1: 156,446,610 L77P probably damaging Het
Sucnr1 T A 3: 60,086,741 V230E probably damaging Het
Supv3l1 T C 10: 62,429,503 K753E probably benign Het
Tango6 T G 8: 106,742,358 L829V possibly damaging Het
Tek T C 4: 94,827,670 V443A probably benign Het
Tet1 A T 10: 62,879,080 L312Q probably damaging Het
Tgm1 A T 14: 55,710,534 N269K probably damaging Het
Thrb A T 14: 18,008,645 D168V probably damaging Het
Tk2 C T 8: 104,231,172 V181I probably benign Het
Tm6sf2 T C 8: 70,074,322 L47P probably damaging Het
Tmcc3 T A 10: 94,579,216 M291K probably benign Het
Tnfrsf21 A G 17: 43,039,899 E318G probably benign Het
Ttc7 T C 17: 87,334,328 V451A probably benign Het
Ugt2b36 A T 5: 87,092,393 D44E probably benign Het
Usp17la G T 7: 104,860,931 V248L probably damaging Het
Utp20 A C 10: 88,752,948 I2453S probably benign Het
Wdr91 A T 6: 34,886,882 I566N possibly damaging Het
Zfp282 A G 6: 47,890,718 D276G probably benign Het
Zfp866 T C 8: 69,765,978 K331E probably benign Het
Zkscan17 A T 11: 59,503,584 W64R possibly damaging Het
Other mutations in Olfr1342
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01823:Olfr1342 APN 4 118689721 missense probably damaging 1.00
IGL02391:Olfr1342 APN 4 118690341 missense probably damaging 1.00
R0648:Olfr1342 UTSW 4 118690072 missense probably benign
R1565:Olfr1342 UTSW 4 118690192 missense probably damaging 1.00
R1675:Olfr1342 UTSW 4 118689948 missense probably benign 0.00
R1823:Olfr1342 UTSW 4 118690192 missense probably damaging 1.00
R2343:Olfr1342 UTSW 4 118690187 missense probably benign 0.30
R4618:Olfr1342 UTSW 4 118689470 utr 3 prime probably benign
R4941:Olfr1342 UTSW 4 118689892 missense possibly damaging 0.76
R5408:Olfr1342 UTSW 4 118690444 missense probably benign 0.00
R5587:Olfr1342 UTSW 4 118689870 missense probably damaging 1.00
R5895:Olfr1342 UTSW 4 118690117 missense probably damaging 0.97
R6023:Olfr1342 UTSW 4 118690074 missense probably damaging 1.00
R6307:Olfr1342 UTSW 4 118689948 missense probably benign 0.00
R6324:Olfr1342 UTSW 4 118690531 start gained probably benign
R6890:Olfr1342 UTSW 4 118689531 missense possibly damaging 0.72
R7218:Olfr1342 UTSW 4 118690018 missense probably benign
R7408:Olfr1342 UTSW 4 118689662 missense probably damaging 0.98
R7555:Olfr1342 UTSW 4 118689642 missense possibly damaging 0.94
R7749:Olfr1342 UTSW 4 118690228 missense probably damaging 1.00
Z1176:Olfr1342 UTSW 4 118690272 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- ACGGCTCATGAGTACAGAGTAG -3'
(R):5'- AGGAAGGACAACTGCAGCTC -3'

Sequencing Primer
(F):5'- CGGCTCATGAGTACAGAGTAGTGAAG -3'
(R):5'- TTCTCCAGCGAATCCCAGG -3'
Posted On2020-06-30