Incidental Mutation 'R8098:Zfp282'
ID 630305
Institutional Source Beutler Lab
Gene Symbol Zfp282
Ensembl Gene ENSMUSG00000025821
Gene Name zinc finger protein 282
Synonyms HUB1
MMRRC Submission 067530-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R8098 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 47854138-47885419 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 47867652 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 276 (D276G)
Ref Sequence ENSEMBL: ENSMUSP00000053643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061890]
AlphaFold E9PVC2
Predicted Effect probably benign
Transcript: ENSMUST00000061890
AA Change: D276G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000053643
Gene: ENSMUSG00000025821
AA Change: D276G

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
low complexity region 66 75 N/A INTRINSIC
Pfam:DUF3669 98 168 1.8e-12 PFAM
KRAB 198 260 1.04e-21 SMART
internal_repeat_1 317 372 1.1e-13 PROSPERO
low complexity region 387 399 N/A INTRINSIC
low complexity region 403 420 N/A INTRINSIC
low complexity region 457 499 N/A INTRINSIC
ZnF_C2H2 514 536 8.94e-3 SMART
ZnF_C2H2 542 564 4.72e-2 SMART
ZnF_C2H2 570 592 1.04e-3 SMART
ZnF_C2H2 598 620 4.24e-4 SMART
ZnF_C2H2 626 648 1.06e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,384,618 (GRCm39) L449P probably damaging Het
Abca15 A G 7: 119,960,619 (GRCm39) S694G probably benign Het
Abcc6 A G 7: 45,646,089 (GRCm39) L800P probably damaging Het
Adam15 T A 3: 89,251,193 (GRCm39) D504V probably damaging Het
Adnp T C 2: 168,024,452 (GRCm39) T948A probably benign Het
Akap11 T C 14: 78,750,362 (GRCm39) D675G Het
Atp13a3 A C 16: 30,173,115 (GRCm39) V254G possibly damaging Het
Atp1a1 A G 3: 101,489,365 (GRCm39) I749T probably damaging Het
B3glct T A 5: 149,673,965 (GRCm39) Y369* probably null Het
Bms1 C T 6: 118,361,219 (GRCm39) R1204H probably damaging Het
Btla T A 16: 45,064,612 (GRCm39) L188* probably null Het
Btn2a2 A G 13: 23,666,058 (GRCm39) V258A probably benign Het
C1ra G A 6: 124,494,684 (GRCm39) E316K probably benign Het
Cacna1g T C 11: 94,307,338 (GRCm39) H1782R probably benign Het
Calcoco1 T C 15: 102,624,759 (GRCm39) D172G probably benign Het
Ccdc192 A T 18: 57,800,403 (GRCm39) I185L probably benign Het
Ciart G A 3: 95,788,656 (GRCm39) P61L probably damaging Het
Ckap4 A G 10: 84,369,499 (GRCm39) S78P probably damaging Het
Col6a3 A T 1: 90,731,383 (GRCm39) D1623E probably benign Het
Col7a1 A G 9: 108,785,763 (GRCm39) T411A unknown Het
Cpt1a A C 19: 3,420,849 (GRCm39) I436L probably benign Het
Cyp2c23 T A 19: 44,004,242 (GRCm39) I173F probably benign Het
Dcun1d2 T C 8: 13,311,396 (GRCm39) T198A probably benign Het
Ddx50 A C 10: 62,460,922 (GRCm39) probably null Het
Depdc1b A G 13: 108,460,593 (GRCm39) T68A probably damaging Het
Dgkq G A 5: 108,800,334 (GRCm39) R546W probably damaging Het
Dmbt1 G A 7: 130,710,188 (GRCm39) W1493* probably null Het
Dnah17 A G 11: 117,941,193 (GRCm39) S3219P probably damaging Het
Egf T A 3: 129,484,486 (GRCm39) Y986F probably benign Het
Ell3 TCTCCTC TCTC 2: 121,269,937 (GRCm39) probably benign Het
Ep400 A T 5: 110,841,117 (GRCm39) M1805K unknown Het
Exoc3 A G 13: 74,320,271 (GRCm39) M730T probably benign Het
Fbxl13 T A 5: 21,825,716 (GRCm39) M129L probably benign Het
Fem1al A G 11: 29,774,450 (GRCm39) S336P possibly damaging Het
Gins4 T A 8: 23,727,037 (GRCm39) M19L probably benign Het
Gm3238 T C 10: 77,606,474 (GRCm39) N229S unknown Het
Gpd2 T A 2: 57,180,020 (GRCm39) V89D possibly damaging Het
Hectd4 G A 5: 121,459,461 (GRCm39) V777I possibly damaging Het
Hgf T A 5: 16,766,059 (GRCm39) V65E probably benign Het
Hnrnpdl A G 5: 100,185,779 (GRCm39) S169P probably benign Het
Igfbp3 T C 11: 7,160,104 (GRCm39) D183G possibly damaging Het
Il16 A G 7: 83,295,767 (GRCm39) V1134A probably damaging Het
Kcnn4 A G 7: 24,083,504 (GRCm39) D395G probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,321,113 (GRCm39) probably benign Het
Kif13a T C 13: 46,968,780 (GRCm39) N354S probably damaging Het
Lrp1 C T 10: 127,410,324 (GRCm39) R1474Q possibly damaging Het
Map3k9 T C 12: 81,780,888 (GRCm39) Q424R probably damaging Het
Mkx A C 18: 6,992,784 (GRCm39) S167A possibly damaging Het
Ms4a14 A G 19: 11,281,979 (GRCm39) F193S possibly damaging Het
Myo18a A T 11: 77,736,227 (GRCm39) D1508V probably damaging Het
Nek4 T A 14: 30,685,908 (GRCm39) N273K probably benign Het
Nipal3 A T 4: 135,179,709 (GRCm39) V403D possibly damaging Het
Nlrp6 G A 7: 140,503,168 (GRCm39) V425M probably damaging Het
Or13p4 A T 4: 118,547,406 (GRCm39) V81E possibly damaging Het
Or14j6 A G 17: 38,215,250 (GRCm39) D271G probably damaging Het
Or4c122 T A 2: 89,079,652 (GRCm39) M117L possibly damaging Het
Or9k2 T C 10: 129,998,916 (GRCm39) K93R probably benign Het
Otub1 A T 19: 7,181,794 (GRCm39) D27E probably damaging Het
Pcnx2 T C 8: 126,495,040 (GRCm39) D1607G probably damaging Het
Pde2a A G 7: 101,071,178 (GRCm39) Y16C probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Prph2 A T 17: 47,230,892 (GRCm39) M262L probably benign Het
Pxdn C T 12: 30,056,601 (GRCm39) L1271F probably damaging Het
Rnf10 A C 5: 115,389,438 (GRCm39) I243S probably damaging Het
Samd9l T C 6: 3,375,549 (GRCm39) I571V probably damaging Het
Scube1 C T 15: 83,543,289 (GRCm39) G183D probably damaging Het
Sidt2 A G 9: 45,857,028 (GRCm39) V426A probably benign Het
Slc20a1 T C 2: 129,051,041 (GRCm39) L566P probably damaging Het
Slc22a3 A G 17: 12,642,619 (GRCm39) probably null Het
Snx11 G T 11: 96,661,500 (GRCm39) S168R probably benign Het
Snx5 T C 2: 144,097,482 (GRCm39) N218D probably benign Het
Snx7 A T 3: 117,632,583 (GRCm39) D169E probably benign Het
Soat1 A G 1: 156,274,180 (GRCm39) L77P probably damaging Het
Sucnr1 T A 3: 59,994,162 (GRCm39) V230E probably damaging Het
Supv3l1 T C 10: 62,265,282 (GRCm39) K753E probably benign Het
Tango6 T G 8: 107,468,990 (GRCm39) L829V possibly damaging Het
Tek T C 4: 94,715,907 (GRCm39) V443A probably benign Het
Tet1 A T 10: 62,714,859 (GRCm39) L312Q probably damaging Het
Tgm1 A T 14: 55,947,991 (GRCm39) N269K probably damaging Het
Thrb A T 14: 18,008,645 (GRCm38) D168V probably damaging Het
Tk2 C T 8: 104,957,804 (GRCm39) V181I probably benign Het
Tm6sf2 T C 8: 70,526,972 (GRCm39) L47P probably damaging Het
Tmcc3 T A 10: 94,415,078 (GRCm39) M291K probably benign Het
Tnfrsf21 A G 17: 43,350,790 (GRCm39) E318G probably benign Het
Ttc7 T C 17: 87,641,756 (GRCm39) V451A probably benign Het
Ugt2b36 A T 5: 87,240,252 (GRCm39) D44E probably benign Het
Usp17la G T 7: 104,510,138 (GRCm39) V248L probably damaging Het
Utp20 A C 10: 88,588,810 (GRCm39) I2453S probably benign Het
Wdr91 A T 6: 34,863,817 (GRCm39) I566N possibly damaging Het
Zfp764l1 C T 7: 126,992,496 (GRCm39) C38Y probably null Het
Zfp866 T C 8: 70,218,628 (GRCm39) K331E probably benign Het
Zkscan17 A T 11: 59,394,410 (GRCm39) W64R possibly damaging Het
Other mutations in Zfp282
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00732:Zfp282 APN 6 47,857,324 (GRCm39) missense probably damaging 1.00
IGL00755:Zfp282 APN 6 47,857,324 (GRCm39) missense probably damaging 1.00
IGL01402:Zfp282 APN 6 47,874,770 (GRCm39) missense probably damaging 0.99
IGL01404:Zfp282 APN 6 47,874,770 (GRCm39) missense probably damaging 0.99
IGL01484:Zfp282 APN 6 47,867,054 (GRCm39) missense possibly damaging 0.76
IGL01560:Zfp282 APN 6 47,857,211 (GRCm39) missense probably damaging 1.00
IGL02949:Zfp282 APN 6 47,874,848 (GRCm39) missense probably damaging 1.00
FR4304:Zfp282 UTSW 6 47,881,731 (GRCm39) small insertion probably benign
FR4589:Zfp282 UTSW 6 47,881,725 (GRCm39) small insertion probably benign
FR4737:Zfp282 UTSW 6 47,881,733 (GRCm39) small insertion probably benign
FR4737:Zfp282 UTSW 6 47,881,724 (GRCm39) small insertion probably benign
FR4976:Zfp282 UTSW 6 47,881,724 (GRCm39) small insertion probably benign
R0020:Zfp282 UTSW 6 47,856,943 (GRCm39) missense probably damaging 1.00
R0020:Zfp282 UTSW 6 47,856,943 (GRCm39) missense probably damaging 1.00
R0118:Zfp282 UTSW 6 47,869,866 (GRCm39) missense probably benign 0.34
R0415:Zfp282 UTSW 6 47,881,987 (GRCm39) missense possibly damaging 0.88
R0415:Zfp282 UTSW 6 47,874,815 (GRCm39) missense probably damaging 0.99
R0607:Zfp282 UTSW 6 47,857,303 (GRCm39) missense probably damaging 1.00
R0710:Zfp282 UTSW 6 47,857,318 (GRCm39) missense probably damaging 1.00
R0946:Zfp282 UTSW 6 47,856,943 (GRCm39) missense probably damaging 1.00
R1054:Zfp282 UTSW 6 47,881,533 (GRCm39) missense probably benign 0.00
R1401:Zfp282 UTSW 6 47,867,108 (GRCm39) nonsense probably null
R1572:Zfp282 UTSW 6 47,869,801 (GRCm39) missense probably damaging 1.00
R2016:Zfp282 UTSW 6 47,874,721 (GRCm39) splice site probably null
R2971:Zfp282 UTSW 6 47,874,866 (GRCm39) splice site probably null
R4064:Zfp282 UTSW 6 47,857,028 (GRCm39) missense probably damaging 0.99
R4478:Zfp282 UTSW 6 47,867,630 (GRCm39) nonsense probably null
R4530:Zfp282 UTSW 6 47,867,567 (GRCm39) missense probably benign 0.00
R4532:Zfp282 UTSW 6 47,867,567 (GRCm39) missense probably benign 0.00
R5068:Zfp282 UTSW 6 47,854,637 (GRCm39) missense probably benign 0.01
R5261:Zfp282 UTSW 6 47,874,824 (GRCm39) missense probably damaging 0.99
R5326:Zfp282 UTSW 6 47,882,261 (GRCm39) missense probably benign
R5551:Zfp282 UTSW 6 47,867,579 (GRCm39) missense possibly damaging 0.59
R6046:Zfp282 UTSW 6 47,857,102 (GRCm39) missense probably damaging 1.00
R6408:Zfp282 UTSW 6 47,857,319 (GRCm39) missense probably damaging 1.00
R7535:Zfp282 UTSW 6 47,881,878 (GRCm39) missense probably benign 0.03
R8158:Zfp282 UTSW 6 47,867,626 (GRCm39) missense possibly damaging 0.61
R8304:Zfp282 UTSW 6 47,881,722 (GRCm39) small deletion probably benign
R8385:Zfp282 UTSW 6 47,882,023 (GRCm39) missense possibly damaging 0.88
R8543:Zfp282 UTSW 6 47,881,561 (GRCm39) missense probably benign 0.40
R8817:Zfp282 UTSW 6 47,881,760 (GRCm39) missense probably benign 0.00
S24628:Zfp282 UTSW 6 47,881,987 (GRCm39) missense possibly damaging 0.88
S24628:Zfp282 UTSW 6 47,874,815 (GRCm39) missense probably damaging 0.99
Z1177:Zfp282 UTSW 6 47,867,571 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATAATGGCTGCCATGCTGTG -3'
(R):5'- CATGTTCTGTAAGTGACCACAC -3'

Sequencing Primer
(F):5'- ACATTGGTAACTGAGAGCCCTGC -3'
(R):5'- ACAACAGCTGTGGTATAAGTGGTTC -3'
Posted On 2020-06-30