Incidental Mutation 'R8098:Abca15'
ID630313
Institutional Source Beutler Lab
Gene Symbol Abca15
Ensembl Gene ENSMUSG00000054746
Gene NameATP-binding cassette, sub-family A (ABC1), member 15
Synonyms4930500I12Rik
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_177213.3; MGI:2388709

Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R8098 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location120328670-120407687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120361396 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 694 (S694G)
Ref Sequence ENSEMBL: ENSMUSP00000075621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076272] [ENSMUST00000121265]
Predicted Effect probably benign
Transcript: ENSMUST00000076272
AA Change: S694G

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000075621
Gene: ENSMUSG00000054746
AA Change: S694G

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 24 464 5.7e-21 PFAM
AAA 550 732 9.14e-11 SMART
Pfam:ABC2_membrane_3 892 1293 7.9e-24 PFAM
AAA 1381 1565 1.16e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121265
AA Change: S694G

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000112821
Gene: ENSMUSG00000054746
AA Change: S694G

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 24 464 2.1e-21 PFAM
AAA 550 732 9.14e-11 SMART
Pfam:ABC2_membrane_3 907 1293 1e-25 PFAM
AAA 1381 1565 1.16e-3 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted(2

Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik A T 18: 57,667,331 I185L probably benign Het
3425401B19Rik A G 14: 32,662,661 L449P probably damaging Het
4931440F15Rik A G 11: 29,824,450 S336P possibly damaging Het
Abcc6 A G 7: 45,996,665 L800P probably damaging Het
Adam15 T A 3: 89,343,886 D504V probably damaging Het
Adnp T C 2: 168,182,532 T948A probably benign Het
Akap11 T C 14: 78,512,922 D675G Het
Atp13a3 A C 16: 30,354,297 V254G possibly damaging Het
Atp1a1 A G 3: 101,582,049 I749T probably damaging Het
B3glct T A 5: 149,750,500 Y369* probably null Het
Bms1 C T 6: 118,384,258 R1204H probably damaging Het
Btla T A 16: 45,244,249 L188* probably null Het
Btn2a2 A G 13: 23,481,888 V258A probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Cacna1g T C 11: 94,416,512 H1782R probably benign Het
Calcoco1 T C 15: 102,716,324 D172G probably benign Het
Ciart G A 3: 95,881,344 P61L probably damaging Het
Ckap4 A G 10: 84,533,635 S78P probably damaging Het
Col6a3 A T 1: 90,803,661 D1623E probably benign Het
Col7a1 A G 9: 108,956,695 T411A unknown Het
Cpt1a A C 19: 3,370,849 I436L probably benign Het
Cyp2c23 T A 19: 44,015,803 I173F probably benign Het
Dcun1d2 T C 8: 13,261,396 T198A probably benign Het
Ddx50 A C 10: 62,625,143 probably null Het
Depdc1b A G 13: 108,324,059 T68A probably damaging Het
Dgkq G A 5: 108,652,468 R546W probably damaging Het
Dmbt1 G A 7: 131,108,459 W1493* probably null Het
Dnah17 A G 11: 118,050,367 S3219P probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Egf T A 3: 129,690,837 Y986F probably benign Het
Ell3 TCTCCTC TCTC 2: 121,439,456 probably benign Het
Ep400 A T 5: 110,693,251 M1805K unknown Het
Exoc3 A G 13: 74,172,152 M730T probably benign Het
Fbxl13 T A 5: 21,620,718 M129L probably benign Het
Gins4 T A 8: 23,237,021 M19L probably benign Het
Gm3238 T C 10: 77,770,640 N229S unknown Het
Gpd2 T A 2: 57,290,008 V89D possibly damaging Het
Hectd4 G A 5: 121,321,398 V777I possibly damaging Het
Hgf T A 5: 16,561,061 V65E probably benign Het
Hnrnpdl A G 5: 100,037,920 S169P probably benign Het
Igfbp3 T C 11: 7,210,104 D183G possibly damaging Het
Il16 A G 7: 83,646,559 V1134A probably damaging Het
Kcnn4 A G 7: 24,384,079 D395G probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Kif13a T C 13: 46,815,304 N354S probably damaging Het
Lrp1 C T 10: 127,574,455 R1474Q possibly damaging Het
Map3k9 T C 12: 81,734,114 Q424R probably damaging Het
Mkx A C 18: 6,992,784 S167A possibly damaging Het
Ms4a14 A G 19: 11,304,615 F193S possibly damaging Het
Myo18a A T 11: 77,845,401 D1508V probably damaging Het
Nek4 T A 14: 30,963,951 N273K probably benign Het
Nipal3 A T 4: 135,452,398 V403D possibly damaging Het
Nlrp6 G A 7: 140,923,255 V425M probably damaging Het
Olfr1228 T A 2: 89,249,308 M117L possibly damaging Het
Olfr127 A G 17: 37,904,359 D271G probably damaging Het
Olfr1342 A T 4: 118,690,209 V81E possibly damaging Het
Olfr825 T C 10: 130,163,047 K93R probably benign Het
Otub1 A T 19: 7,204,429 D27E probably damaging Het
Pcnx2 T C 8: 125,768,301 D1607G probably damaging Het
Pde2a A G 7: 101,421,971 Y16C probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Prph2 A T 17: 46,919,966 M262L probably benign Het
Pxdn C T 12: 30,006,602 L1271F probably damaging Het
Rnf10 A C 5: 115,251,379 I243S probably damaging Het
Samd9l T C 6: 3,375,549 I571V probably damaging Het
Scube1 C T 15: 83,659,088 G183D probably damaging Het
Sidt2 A G 9: 45,945,730 V426A probably benign Het
Slc20a1 T C 2: 129,209,121 L566P probably damaging Het
Slc22a3 A G 17: 12,423,732 probably null Het
Snx11 G T 11: 96,770,674 S168R probably benign Het
Snx5 T C 2: 144,255,562 N218D probably benign Het
Snx7 A T 3: 117,838,934 D169E probably benign Het
Soat1 A G 1: 156,446,610 L77P probably damaging Het
Sucnr1 T A 3: 60,086,741 V230E probably damaging Het
Supv3l1 T C 10: 62,429,503 K753E probably benign Het
Tango6 T G 8: 106,742,358 L829V possibly damaging Het
Tek T C 4: 94,827,670 V443A probably benign Het
Tet1 A T 10: 62,879,080 L312Q probably damaging Het
Tgm1 A T 14: 55,710,534 N269K probably damaging Het
Thrb A T 14: 18,008,645 D168V probably damaging Het
Tk2 C T 8: 104,231,172 V181I probably benign Het
Tm6sf2 T C 8: 70,074,322 L47P probably damaging Het
Tmcc3 T A 10: 94,579,216 M291K probably benign Het
Tnfrsf21 A G 17: 43,039,899 E318G probably benign Het
Ttc7 T C 17: 87,334,328 V451A probably benign Het
Ugt2b36 A T 5: 87,092,393 D44E probably benign Het
Usp17la G T 7: 104,860,931 V248L probably damaging Het
Utp20 A C 10: 88,752,948 I2453S probably benign Het
Wdr91 A T 6: 34,886,882 I566N possibly damaging Het
Zfp282 A G 6: 47,890,718 D276G probably benign Het
Zfp866 T C 8: 69,765,978 K331E probably benign Het
Zkscan17 A T 11: 59,503,584 W64R possibly damaging Het
Other mutations in Abca15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Abca15 APN 7 120397054 missense probably damaging 1.00
IGL00505:Abca15 APN 7 120369236 critical splice donor site probably null
IGL00851:Abca15 APN 7 120340007 missense probably damaging 1.00
IGL00985:Abca15 APN 7 120397018 missense probably damaging 1.00
IGL01114:Abca15 APN 7 120361420 missense probably damaging 0.99
IGL01287:Abca15 APN 7 120332858 utr 3 prime probably benign
IGL01333:Abca15 APN 7 120382308 missense probably damaging 1.00
IGL01482:Abca15 APN 7 120382746 missense probably benign 0.00
IGL01610:Abca15 APN 7 120340644 missense probably damaging 0.98
IGL02238:Abca15 APN 7 120396606 missense probably benign 0.02
IGL02377:Abca15 APN 7 120365910 splice site probably benign
IGL02666:Abca15 APN 7 120335208 missense probably damaging 1.00
IGL02836:Abca15 APN 7 120388216 missense probably benign
IGL03337:Abca15 APN 7 120396707 missense probably benign 0.24
IGL03354:Abca15 APN 7 120394488 nonsense probably null
H8562:Abca15 UTSW 7 120374854 splice site probably benign
IGL03098:Abca15 UTSW 7 120388276 splice site probably null
R0029:Abca15 UTSW 7 120346002 missense probably benign 0.01
R0029:Abca15 UTSW 7 120346002 missense probably benign 0.01
R0076:Abca15 UTSW 7 120373685 splice site probably benign
R0165:Abca15 UTSW 7 120350903 splice site probably benign
R0311:Abca15 UTSW 7 120402904 missense probably damaging 0.98
R0387:Abca15 UTSW 7 120332852 critical splice donor site probably null
R0610:Abca15 UTSW 7 120365786 missense possibly damaging 0.75
R0612:Abca15 UTSW 7 120337255 missense probably damaging 1.00
R0704:Abca15 UTSW 7 120354523 missense probably damaging 0.98
R0890:Abca15 UTSW 7 120373713 missense probably benign 0.01
R0961:Abca15 UTSW 7 120360985 nonsense probably null
R1144:Abca15 UTSW 7 120360860 splice site probably benign
R1412:Abca15 UTSW 7 120345323 missense possibly damaging 0.93
R1419:Abca15 UTSW 7 120374902 missense probably benign 0.10
R1467:Abca15 UTSW 7 120340538 splice site probably null
R1467:Abca15 UTSW 7 120340538 splice site probably null
R1469:Abca15 UTSW 7 120382497 missense probably benign 0.00
R1469:Abca15 UTSW 7 120382497 missense probably benign 0.00
R1493:Abca15 UTSW 7 120382290 missense probably benign 0.00
R1513:Abca15 UTSW 7 120340099 missense probably damaging 0.96
R1702:Abca15 UTSW 7 120382702 missense probably benign 0.10
R1857:Abca15 UTSW 7 120361369 missense probably damaging 1.00
R1893:Abca15 UTSW 7 120340553 missense possibly damaging 0.85
R1901:Abca15 UTSW 7 120346099 missense probably damaging 1.00
R1951:Abca15 UTSW 7 120361432 missense probably damaging 1.00
R1953:Abca15 UTSW 7 120361432 missense probably damaging 1.00
R1962:Abca15 UTSW 7 120341245 missense probably damaging 1.00
R2063:Abca15 UTSW 7 120360904 missense possibly damaging 0.61
R2141:Abca15 UTSW 7 120407474 missense probably damaging 1.00
R2145:Abca15 UTSW 7 120354478 missense probably benign 0.08
R2182:Abca15 UTSW 7 120340227 nonsense probably null
R2425:Abca15 UTSW 7 120359810 missense probably damaging 1.00
R2444:Abca15 UTSW 7 120365897 missense probably damaging 1.00
R3023:Abca15 UTSW 7 120382779 missense probably benign 0.40
R3079:Abca15 UTSW 7 120385169 missense probably damaging 1.00
R3106:Abca15 UTSW 7 120396633 missense possibly damaging 0.63
R3622:Abca15 UTSW 7 120350813 nonsense probably null
R4085:Abca15 UTSW 7 120382726 missense probably damaging 1.00
R4233:Abca15 UTSW 7 120402979 nonsense probably null
R4591:Abca15 UTSW 7 120382413 missense probably damaging 1.00
R4612:Abca15 UTSW 7 120335161 missense probably benign 0.03
R4721:Abca15 UTSW 7 120350775 missense probably benign 0.01
R4838:Abca15 UTSW 7 120345300 missense probably benign 0.00
R4940:Abca15 UTSW 7 120332694 missense probably benign
R4963:Abca15 UTSW 7 120360919 missense probably damaging 1.00
R4993:Abca15 UTSW 7 120401718 missense probably damaging 0.99
R5022:Abca15 UTSW 7 120346096 missense probably damaging 0.98
R5030:Abca15 UTSW 7 120340001 missense probably damaging 1.00
R5072:Abca15 UTSW 7 120406975 missense probably damaging 1.00
R5090:Abca15 UTSW 7 120385199 missense probably damaging 1.00
R5309:Abca15 UTSW 7 120345369 missense probably damaging 0.96
R5310:Abca15 UTSW 7 120332616 missense possibly damaging 0.46
R5312:Abca15 UTSW 7 120345369 missense probably damaging 0.96
R5482:Abca15 UTSW 7 120369147 missense probably damaging 1.00
R5596:Abca15 UTSW 7 120401749 missense possibly damaging 0.94
R5853:Abca15 UTSW 7 120340583 missense probably benign 0.00
R5950:Abca15 UTSW 7 120382656 missense probably damaging 1.00
R5953:Abca15 UTSW 7 120361018 missense probably damaging 1.00
R6072:Abca15 UTSW 7 120388258 missense probably damaging 0.98
R6131:Abca15 UTSW 7 120340205 missense probably benign 0.03
R6132:Abca15 UTSW 7 120361420 missense probably benign 0.14
R6136:Abca15 UTSW 7 120340049 missense possibly damaging 0.81
R6207:Abca15 UTSW 7 120373794 missense probably benign 0.01
R6315:Abca15 UTSW 7 120346092 missense probably damaging 1.00
R6417:Abca15 UTSW 7 120397128 missense possibly damaging 0.95
R6420:Abca15 UTSW 7 120397128 missense possibly damaging 0.95
R6595:Abca15 UTSW 7 120394487 missense probably benign 0.00
R6653:Abca15 UTSW 7 120346006 missense probably benign 0.03
R6859:Abca15 UTSW 7 120402994 nonsense probably null
R6983:Abca15 UTSW 7 120354463 missense probably benign 0.26
R7127:Abca15 UTSW 7 120332602 missense probably benign 0.06
R7205:Abca15 UTSW 7 120394364 missense possibly damaging 0.89
R7336:Abca15 UTSW 7 120388233 missense possibly damaging 0.66
R7426:Abca15 UTSW 7 120345998 missense possibly damaging 0.88
R7745:Abca15 UTSW 7 120332217 missense probably damaging 1.00
R7751:Abca15 UTSW 7 120365821 missense possibly damaging 0.72
R7806:Abca15 UTSW 7 120332836 missense probably damaging 0.96
R8042:Abca15 UTSW 7 120403010 missense possibly damaging 0.95
R8153:Abca15 UTSW 7 120400589 missense probably damaging 1.00
R8247:Abca15 UTSW 7 120337222 missense possibly damaging 0.83
R8259:Abca15 UTSW 7 120340199 missense probably benign 0.00
R8272:Abca15 UTSW 7 120407442 missense probably damaging 1.00
R8295:Abca15 UTSW 7 120374965 missense probably benign 0.00
RF018:Abca15 UTSW 7 120394460 missense possibly damaging 0.50
Z1176:Abca15 UTSW 7 120346026 missense probably benign 0.22
Z1176:Abca15 UTSW 7 120382505 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCTTTAGTACAAAAGTCCTAGTC -3'
(R):5'- AGGGAACAGCATCCTAAGAATAATC -3'

Sequencing Primer
(F):5'- AGAGCAAGCCTAGTACTG -3'
(R):5'- CAGCATCCTAAGAATAATCAAAGGTG -3'
Posted On2020-06-30