Incidental Mutation 'R8098:Ddx50'
ID 630328
Institutional Source Beutler Lab
Gene Symbol Ddx50
Ensembl Gene ENSMUSG00000020076
Gene Name DExD box helicase 50
Synonyms RH-II/Gubeta, GU2, 4933429B04Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 50, 8430408E17Rik
MMRRC Submission 067530-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.165) question?
Stock # R8098 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 62451674-62486997 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to C at 62460922 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020270]
AlphaFold Q99MJ9
Predicted Effect probably null
Transcript: ENSMUST00000020270
SMART Domains Protein: ENSMUSP00000020270
Gene: ENSMUSG00000020076

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
low complexity region 58 65 N/A INTRINSIC
Blast:DEXDc 66 104 3e-8 BLAST
low complexity region 105 122 N/A INTRINSIC
DEXDc 153 354 1.97e-52 SMART
HELICc 398 480 1.8e-28 SMART
low complexity region 558 564 N/A INTRINSIC
Pfam:GUCT 568 662 3.7e-31 PFAM
low complexity region 674 728 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218304
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box enzyme that may be involved in ribosomal RNA synthesis or processing. This gene and DDX21, also called RH-II/GuA, have similar genomic structures and are in tandem orientation on chromosome 10, suggesting that the two genes arose by gene duplication in evolution. This gene has pseudogenes on chromosomes 2, 3 and 4. Alternative splicing of this gene generates multiple transcript variants, but the full length nature of all the other variants but one has not been defined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,384,618 (GRCm39) L449P probably damaging Het
Abca15 A G 7: 119,960,619 (GRCm39) S694G probably benign Het
Abcc6 A G 7: 45,646,089 (GRCm39) L800P probably damaging Het
Adam15 T A 3: 89,251,193 (GRCm39) D504V probably damaging Het
Adnp T C 2: 168,024,452 (GRCm39) T948A probably benign Het
Akap11 T C 14: 78,750,362 (GRCm39) D675G Het
Atp13a3 A C 16: 30,173,115 (GRCm39) V254G possibly damaging Het
Atp1a1 A G 3: 101,489,365 (GRCm39) I749T probably damaging Het
B3glct T A 5: 149,673,965 (GRCm39) Y369* probably null Het
Bms1 C T 6: 118,361,219 (GRCm39) R1204H probably damaging Het
Btla T A 16: 45,064,612 (GRCm39) L188* probably null Het
Btn2a2 A G 13: 23,666,058 (GRCm39) V258A probably benign Het
C1ra G A 6: 124,494,684 (GRCm39) E316K probably benign Het
Cacna1g T C 11: 94,307,338 (GRCm39) H1782R probably benign Het
Calcoco1 T C 15: 102,624,759 (GRCm39) D172G probably benign Het
Ccdc192 A T 18: 57,800,403 (GRCm39) I185L probably benign Het
Ciart G A 3: 95,788,656 (GRCm39) P61L probably damaging Het
Ckap4 A G 10: 84,369,499 (GRCm39) S78P probably damaging Het
Col6a3 A T 1: 90,731,383 (GRCm39) D1623E probably benign Het
Col7a1 A G 9: 108,785,763 (GRCm39) T411A unknown Het
Cpt1a A C 19: 3,420,849 (GRCm39) I436L probably benign Het
Cyp2c23 T A 19: 44,004,242 (GRCm39) I173F probably benign Het
Dcun1d2 T C 8: 13,311,396 (GRCm39) T198A probably benign Het
Depdc1b A G 13: 108,460,593 (GRCm39) T68A probably damaging Het
Dgkq G A 5: 108,800,334 (GRCm39) R546W probably damaging Het
Dmbt1 G A 7: 130,710,188 (GRCm39) W1493* probably null Het
Dnah17 A G 11: 117,941,193 (GRCm39) S3219P probably damaging Het
Egf T A 3: 129,484,486 (GRCm39) Y986F probably benign Het
Ell3 TCTCCTC TCTC 2: 121,269,937 (GRCm39) probably benign Het
Ep400 A T 5: 110,841,117 (GRCm39) M1805K unknown Het
Exoc3 A G 13: 74,320,271 (GRCm39) M730T probably benign Het
Fbxl13 T A 5: 21,825,716 (GRCm39) M129L probably benign Het
Fem1al A G 11: 29,774,450 (GRCm39) S336P possibly damaging Het
Gins4 T A 8: 23,727,037 (GRCm39) M19L probably benign Het
Gm3238 T C 10: 77,606,474 (GRCm39) N229S unknown Het
Gpd2 T A 2: 57,180,020 (GRCm39) V89D possibly damaging Het
Hectd4 G A 5: 121,459,461 (GRCm39) V777I possibly damaging Het
Hgf T A 5: 16,766,059 (GRCm39) V65E probably benign Het
Hnrnpdl A G 5: 100,185,779 (GRCm39) S169P probably benign Het
Igfbp3 T C 11: 7,160,104 (GRCm39) D183G possibly damaging Het
Il16 A G 7: 83,295,767 (GRCm39) V1134A probably damaging Het
Kcnn4 A G 7: 24,083,504 (GRCm39) D395G probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,321,113 (GRCm39) probably benign Het
Kif13a T C 13: 46,968,780 (GRCm39) N354S probably damaging Het
Lrp1 C T 10: 127,410,324 (GRCm39) R1474Q possibly damaging Het
Map3k9 T C 12: 81,780,888 (GRCm39) Q424R probably damaging Het
Mkx A C 18: 6,992,784 (GRCm39) S167A possibly damaging Het
Ms4a14 A G 19: 11,281,979 (GRCm39) F193S possibly damaging Het
Myo18a A T 11: 77,736,227 (GRCm39) D1508V probably damaging Het
Nek4 T A 14: 30,685,908 (GRCm39) N273K probably benign Het
Nipal3 A T 4: 135,179,709 (GRCm39) V403D possibly damaging Het
Nlrp6 G A 7: 140,503,168 (GRCm39) V425M probably damaging Het
Or13p4 A T 4: 118,547,406 (GRCm39) V81E possibly damaging Het
Or14j6 A G 17: 38,215,250 (GRCm39) D271G probably damaging Het
Or4c122 T A 2: 89,079,652 (GRCm39) M117L possibly damaging Het
Or9k2 T C 10: 129,998,916 (GRCm39) K93R probably benign Het
Otub1 A T 19: 7,181,794 (GRCm39) D27E probably damaging Het
Pcnx2 T C 8: 126,495,040 (GRCm39) D1607G probably damaging Het
Pde2a A G 7: 101,071,178 (GRCm39) Y16C probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Prph2 A T 17: 47,230,892 (GRCm39) M262L probably benign Het
Pxdn C T 12: 30,056,601 (GRCm39) L1271F probably damaging Het
Rnf10 A C 5: 115,389,438 (GRCm39) I243S probably damaging Het
Samd9l T C 6: 3,375,549 (GRCm39) I571V probably damaging Het
Scube1 C T 15: 83,543,289 (GRCm39) G183D probably damaging Het
Sidt2 A G 9: 45,857,028 (GRCm39) V426A probably benign Het
Slc20a1 T C 2: 129,051,041 (GRCm39) L566P probably damaging Het
Slc22a3 A G 17: 12,642,619 (GRCm39) probably null Het
Snx11 G T 11: 96,661,500 (GRCm39) S168R probably benign Het
Snx5 T C 2: 144,097,482 (GRCm39) N218D probably benign Het
Snx7 A T 3: 117,632,583 (GRCm39) D169E probably benign Het
Soat1 A G 1: 156,274,180 (GRCm39) L77P probably damaging Het
Sucnr1 T A 3: 59,994,162 (GRCm39) V230E probably damaging Het
Supv3l1 T C 10: 62,265,282 (GRCm39) K753E probably benign Het
Tango6 T G 8: 107,468,990 (GRCm39) L829V possibly damaging Het
Tek T C 4: 94,715,907 (GRCm39) V443A probably benign Het
Tet1 A T 10: 62,714,859 (GRCm39) L312Q probably damaging Het
Tgm1 A T 14: 55,947,991 (GRCm39) N269K probably damaging Het
Thrb A T 14: 18,008,645 (GRCm38) D168V probably damaging Het
Tk2 C T 8: 104,957,804 (GRCm39) V181I probably benign Het
Tm6sf2 T C 8: 70,526,972 (GRCm39) L47P probably damaging Het
Tmcc3 T A 10: 94,415,078 (GRCm39) M291K probably benign Het
Tnfrsf21 A G 17: 43,350,790 (GRCm39) E318G probably benign Het
Ttc7 T C 17: 87,641,756 (GRCm39) V451A probably benign Het
Ugt2b36 A T 5: 87,240,252 (GRCm39) D44E probably benign Het
Usp17la G T 7: 104,510,138 (GRCm39) V248L probably damaging Het
Utp20 A C 10: 88,588,810 (GRCm39) I2453S probably benign Het
Wdr91 A T 6: 34,863,817 (GRCm39) I566N possibly damaging Het
Zfp282 A G 6: 47,867,652 (GRCm39) D276G probably benign Het
Zfp764l1 C T 7: 126,992,496 (GRCm39) C38Y probably null Het
Zfp866 T C 8: 70,218,628 (GRCm39) K331E probably benign Het
Zkscan17 A T 11: 59,394,410 (GRCm39) W64R possibly damaging Het
Other mutations in Ddx50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01517:Ddx50 APN 10 62,482,911 (GRCm39) missense probably benign
IGL01955:Ddx50 APN 10 62,482,962 (GRCm39) missense probably benign
IGL02677:Ddx50 APN 10 62,452,072 (GRCm39) missense unknown
IGL03169:Ddx50 APN 10 62,457,166 (GRCm39) critical splice donor site probably null
IGL03372:Ddx50 APN 10 62,479,109 (GRCm39) missense probably benign 0.11
K7371:Ddx50 UTSW 10 62,457,289 (GRCm39) start codon destroyed probably null
R0123:Ddx50 UTSW 10 62,457,156 (GRCm39) splice site probably benign
R0134:Ddx50 UTSW 10 62,457,156 (GRCm39) splice site probably benign
R0318:Ddx50 UTSW 10 62,478,616 (GRCm39) missense probably damaging 1.00
R0731:Ddx50 UTSW 10 62,452,028 (GRCm39) missense unknown
R1244:Ddx50 UTSW 10 62,478,703 (GRCm39) missense probably damaging 1.00
R1429:Ddx50 UTSW 10 62,482,847 (GRCm39) missense possibly damaging 0.45
R2005:Ddx50 UTSW 10 62,476,243 (GRCm39) missense probably benign 0.10
R2924:Ddx50 UTSW 10 62,463,373 (GRCm39) missense probably damaging 1.00
R3803:Ddx50 UTSW 10 62,475,723 (GRCm39) missense probably damaging 1.00
R3861:Ddx50 UTSW 10 62,478,725 (GRCm39) missense possibly damaging 0.91
R4169:Ddx50 UTSW 10 62,476,549 (GRCm39) nonsense probably null
R4917:Ddx50 UTSW 10 62,463,450 (GRCm39) nonsense probably null
R4918:Ddx50 UTSW 10 62,463,450 (GRCm39) nonsense probably null
R4951:Ddx50 UTSW 10 62,469,899 (GRCm39) missense probably damaging 0.99
R4962:Ddx50 UTSW 10 62,478,632 (GRCm39) missense probably damaging 1.00
R5102:Ddx50 UTSW 10 62,476,640 (GRCm39) missense probably damaging 1.00
R5403:Ddx50 UTSW 10 62,482,809 (GRCm39) missense probably benign
R5648:Ddx50 UTSW 10 62,452,049 (GRCm39) missense unknown
R5899:Ddx50 UTSW 10 62,476,596 (GRCm39) nonsense probably null
R6127:Ddx50 UTSW 10 62,457,342 (GRCm39) splice site probably null
R6244:Ddx50 UTSW 10 62,457,345 (GRCm39) splice site probably null
R8163:Ddx50 UTSW 10 62,475,678 (GRCm39) missense possibly damaging 0.93
R8257:Ddx50 UTSW 10 62,452,299 (GRCm39) splice site probably benign
R8272:Ddx50 UTSW 10 62,457,256 (GRCm39) missense probably benign 0.05
R8356:Ddx50 UTSW 10 62,457,287 (GRCm39) missense probably benign 0.04
R8537:Ddx50 UTSW 10 62,478,628 (GRCm39) missense probably damaging 1.00
R8540:Ddx50 UTSW 10 62,476,569 (GRCm39) missense possibly damaging 0.94
R8759:Ddx50 UTSW 10 62,452,021 (GRCm39) missense unknown
R8995:Ddx50 UTSW 10 62,469,862 (GRCm39) missense probably damaging 1.00
R9001:Ddx50 UTSW 10 62,475,728 (GRCm39) missense probably benign 0.27
R9691:Ddx50 UTSW 10 62,476,524 (GRCm39) missense probably benign 0.03
R9799:Ddx50 UTSW 10 62,469,812 (GRCm39) missense probably damaging 1.00
X0026:Ddx50 UTSW 10 62,460,970 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGAAGCCAGAGACCTGTG -3'
(R):5'- CTAGGGCTTGGTAATCTTTTAAGTC -3'

Sequencing Primer
(F):5'- AAATGTTCTTGGTCAGGATACAGG -3'
(R):5'- AATGACGACTTCCTTTTTCT -3'
Posted On 2020-06-30