Incidental Mutation 'R0701:Ifnar2'
ID63033
Institutional Source Beutler Lab
Gene Symbol Ifnar2
Ensembl Gene ENSMUSG00000022971
Gene Nameinterferon (alpha and beta) receptor 2
SynonymsIfnar-2
MMRRC Submission 038884-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R0701 (G1)
Quality Score100
Status Not validated
Chromosome16
Chromosomal Location91372783-91405589 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91404229 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 453 (T453A)
Ref Sequence ENSEMBL: ENSMUSP00000023693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023691] [ENSMUST00000023693] [ENSMUST00000089042] [ENSMUST00000156133]
Predicted Effect probably benign
Transcript: ENSMUST00000023691
SMART Domains Protein: ENSMUSP00000023691
Gene: ENSMUSG00000022969

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FN3 23 100 4.6e-2 SMART
FN3 114 204 7.1e-3 SMART
transmembrane domain 228 250 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000023693
AA Change: T453A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000023693
Gene: ENSMUSG00000022971
AA Change: T453A

DomainStartEndE-ValueType
Pfam:Tissue_fac 9 118 8.9e-18 PFAM
Pfam:Interfer-bind 132 231 9.2e-19 PFAM
low complexity region 315 326 N/A INTRINSIC
low complexity region 361 389 N/A INTRINSIC
low complexity region 476 485 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089042
SMART Domains Protein: ENSMUSP00000086443
Gene: ENSMUSG00000022971

DomainStartEndE-ValueType
Pfam:Tissue_fac 9 118 2.9e-18 PFAM
Pfam:Interfer-bind 132 231 1.5e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137612
Predicted Effect probably benign
Transcript: ENSMUST00000144215
SMART Domains Protein: ENSMUSP00000120485
Gene: ENSMUSG00000022969

DomainStartEndE-ValueType
Pfam:Tissue_fac 7 65 1.7e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152729
Predicted Effect probably benign
Transcript: ENSMUST00000156133
SMART Domains Protein: ENSMUSP00000120227
Gene: ENSMUSG00000022969

DomainStartEndE-ValueType
low complexity region 39 48 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160764
SMART Domains Protein: ENSMUSP00000123997
Gene: ENSMUSG00000093701

DomainStartEndE-ValueType
FN3 2 92 5.1e1 SMART
FN3 110 187 9.09e0 SMART
FN3 201 291 1.39e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161517
SMART Domains Protein: ENSMUSP00000125579
Gene: ENSMUSG00000093701

DomainStartEndE-ValueType
Pfam:Interfer-bind 1 100 7.5e-20 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I membrane protein that forms one of the two chains of a receptor for interferons alpha and beta. Binding and activation of the receptor stimulates Janus protein kinases, which in turn phosphorylate several proteins, including STAT1 and STAT2. Multiple transcript variants encoding at least two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice with mutations of this gene have defects in immune responses involving, variously, NK cells, CD4+ and CD8+ T cells and B cells in response to induced and transplanted tumors, viruses, and double stranded DNA. These defects include diminished secretion of type I and type II interferons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ada A G 2: 163,730,075 V261A probably benign Het
Arhgef10 T A 8: 14,962,636 V320E probably damaging Het
Arhgef11 G T 3: 87,733,459 A1308S probably benign Het
Bach1 G A 16: 87,719,989 E473K probably damaging Het
Bsph1 G T 7: 13,472,256 C72F probably damaging Het
C2cd2l A G 9: 44,316,202 L186P probably damaging Het
C9 A C 15: 6,467,421 T200P probably damaging Het
Cald1 AAGAGAGAGAGAGAG AAGAGAGAGAGAG 6: 34,746,173 probably null Het
Chd1 C A 17: 15,725,431 N72K probably benign Het
Copg1 T A 6: 87,894,107 Y268* probably null Het
Csad A G 15: 102,179,136 S331P probably benign Het
Ddx31 G T 2: 28,858,777 R239L probably null Het
Fat1 G T 8: 45,026,553 A2879S probably benign Het
Fig4 T A 10: 41,240,512 R628* probably null Het
Fmnl3 T C 15: 99,321,307 N778S probably damaging Het
Gm10912 T C 2: 104,066,530 S5P probably benign Het
Gm13088 C T 4: 143,656,440 E70K possibly damaging Het
Haus3 G A 5: 34,166,015 T417M probably benign Het
Herc1 T G 9: 66,487,950 V4189G probably damaging Het
Hoxb3 C A 11: 96,346,248 S384* probably null Het
Ift140 A G 17: 25,090,933 T1105A probably benign Het
Kmt2e T C 5: 23,473,583 V220A probably benign Het
Lrriq1 A T 10: 103,234,044 V37E probably benign Het
Lrrn4 G A 2: 132,870,160 T581M probably benign Het
Mcur1 T C 13: 43,545,740 Y267C probably damaging Het
Mdn1 T A 4: 32,699,263 D1313E probably benign Het
Med13 T A 11: 86,307,038 T736S probably benign Het
Mlh3 A T 12: 85,267,903 I503K probably benign Het
Nckap5 A G 1: 126,025,357 F1089L probably benign Het
Olfr1258 A G 2: 89,930,201 T131A probably benign Het
Olfr1298 C T 2: 111,645,791 V69I probably benign Het
Olfr395 A T 11: 73,906,829 I221N probably damaging Het
Pdgfd A T 9: 6,359,706 D259V probably damaging Het
R3hdm1 A G 1: 128,181,739 Y309C probably damaging Het
Rab27b A T 18: 69,985,199 C216S probably damaging Het
Robo2 A G 16: 74,046,874 I151T probably damaging Het
Sh2d4a A G 8: 68,331,095 D227G probably damaging Het
Sis G T 3: 72,941,045 T632K probably damaging Het
Smcr8 T C 11: 60,778,115 Y30H probably damaging Het
Stap1 T C 5: 86,094,808 probably null Het
Syt16 G A 12: 74,235,112 V337I probably benign Het
Taf1c A T 8: 119,599,983 I438N probably damaging Het
Ttn A G 2: 76,898,068 probably benign Het
Unc45b T A 11: 82,940,205 L797Q possibly damaging Het
Usp6nl A G 2: 6,415,018 E144G possibly damaging Het
Wiz A T 17: 32,356,441 I907N probably damaging Het
Zap70 G A 1: 36,781,177 R513Q probably damaging Het
Other mutations in Ifnar2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Ifnar2 APN 16 91391711 unclassified probably benign
IGL02817:Ifnar2 APN 16 91387992 missense probably benign 0.01
macro-2 UTSW 16 91383899 start codon destroyed probably null
R1342:Ifnar2 UTSW 16 91403921 missense possibly damaging 0.85
R1542:Ifnar2 UTSW 16 91399265 missense possibly damaging 0.95
R1631:Ifnar2 UTSW 16 91391867 missense probably benign 0.00
R1913:Ifnar2 UTSW 16 91404170 missense probably benign 0.33
R3078:Ifnar2 UTSW 16 91386001 missense possibly damaging 0.86
R4193:Ifnar2 UTSW 16 91404344 missense probably damaging 0.98
R4592:Ifnar2 UTSW 16 91391796 missense probably benign
R5385:Ifnar2 UTSW 16 91404198 missense possibly damaging 0.70
R5545:Ifnar2 UTSW 16 91385025 critical splice donor site probably null
R5645:Ifnar2 UTSW 16 91404227 missense possibly damaging 0.85
R6223:Ifnar2 UTSW 16 91387988 missense probably damaging 0.98
R6371:Ifnar2 UTSW 16 91388098 missense possibly damaging 0.95
R6710:Ifnar2 UTSW 16 91393883 missense probably damaging 0.98
R6929:Ifnar2 UTSW 16 91393878 nonsense probably null
R7530:Ifnar2 UTSW 16 91404313 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- GCGCTGAGGAATCTGATGAAGCTG -3'
(R):5'- GACCCCTGTAAACAATCCTGATGCC -3'

Sequencing Primer
(F):5'- TGGAGCTGAGCCAGAACTC -3'
(R):5'- AGTCATCTCATGATGTAGCCG -3'
Posted On2013-07-30