Incidental Mutation 'R8098:Pxdn'
ID630343
Institutional Source Beutler Lab
Gene Symbol Pxdn
Ensembl Gene ENSMUSG00000020674
Gene Nameperoxidasin
SynonymsVPO1, 2310075M15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.600) question?
Stock #R8098 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location29937608-30017658 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 30006602 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 1271 (L1271F)
Ref Sequence ENSEMBL: ENSMUSP00000113703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122328] [ENSMUST00000220271]
Predicted Effect probably damaging
Transcript: ENSMUST00000122328
AA Change: L1271F

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113703
Gene: ENSMUSG00000020674
AA Change: L1271F

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LRRNT 32 63 2.52e-1 SMART
LRR 62 81 4.09e1 SMART
LRR_TYP 82 105 3.69e-4 SMART
LRR_TYP 106 129 1.45e-2 SMART
LRR_TYP 130 153 8.02e-5 SMART
LRR_TYP 154 177 1.06e-4 SMART
LRRCT 189 241 3.97e-5 SMART
IGc2 255 321 1.59e-15 SMART
IGc2 351 416 3.96e-16 SMART
IGc2 442 506 2.96e-15 SMART
IGc2 534 598 1.2e-15 SMART
Pfam:An_peroxidase 738 1286 1.1e-196 PFAM
VWC 1411 1466 8.8e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000220271
AA Change: L1091F

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heme-containing peroxidase that is secreted into the extracellular matrix. It is involved in extracellular matrix formation, and may function in the physiological and pathological fibrogenic response in fibrotic kidney. Mutations in this gene cause corneal opacification and other ocular anomalies, and also microphthalmia and anterior segment dysgenesis. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit abnormal eye development with early-onset glaucoma and progressive retinal dysgenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik A T 18: 57,667,331 I185L probably benign Het
3425401B19Rik A G 14: 32,662,661 L449P probably damaging Het
4931440F15Rik A G 11: 29,824,450 S336P possibly damaging Het
Abca15 A G 7: 120,361,396 S694G probably benign Het
Abcc6 A G 7: 45,996,665 L800P probably damaging Het
Adam15 T A 3: 89,343,886 D504V probably damaging Het
Adnp T C 2: 168,182,532 T948A probably benign Het
Akap11 T C 14: 78,512,922 D675G Het
Atp13a3 A C 16: 30,354,297 V254G possibly damaging Het
Atp1a1 A G 3: 101,582,049 I749T probably damaging Het
B3glct T A 5: 149,750,500 Y369* probably null Het
Bms1 C T 6: 118,384,258 R1204H probably damaging Het
Btla T A 16: 45,244,249 L188* probably null Het
Btn2a2 A G 13: 23,481,888 V258A probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Cacna1g T C 11: 94,416,512 H1782R probably benign Het
Calcoco1 T C 15: 102,716,324 D172G probably benign Het
Ciart G A 3: 95,881,344 P61L probably damaging Het
Ckap4 A G 10: 84,533,635 S78P probably damaging Het
Col6a3 A T 1: 90,803,661 D1623E probably benign Het
Col7a1 A G 9: 108,956,695 T411A unknown Het
Cpt1a A C 19: 3,370,849 I436L probably benign Het
Cyp2c23 T A 19: 44,015,803 I173F probably benign Het
Dcun1d2 T C 8: 13,261,396 T198A probably benign Het
Ddx50 A C 10: 62,625,143 probably null Het
Depdc1b A G 13: 108,324,059 T68A probably damaging Het
Dgkq G A 5: 108,652,468 R546W probably damaging Het
Dmbt1 G A 7: 131,108,459 W1493* probably null Het
Dnah17 A G 11: 118,050,367 S3219P probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Egf T A 3: 129,690,837 Y986F probably benign Het
Ell3 TCTCCTC TCTC 2: 121,439,456 probably benign Het
Ep400 A T 5: 110,693,251 M1805K unknown Het
Exoc3 A G 13: 74,172,152 M730T probably benign Het
Fbxl13 T A 5: 21,620,718 M129L probably benign Het
Gins4 T A 8: 23,237,021 M19L probably benign Het
Gm3238 T C 10: 77,770,640 N229S unknown Het
Gpd2 T A 2: 57,290,008 V89D possibly damaging Het
Hectd4 G A 5: 121,321,398 V777I possibly damaging Het
Hgf T A 5: 16,561,061 V65E probably benign Het
Hnrnpdl A G 5: 100,037,920 S169P probably benign Het
Igfbp3 T C 11: 7,210,104 D183G possibly damaging Het
Il16 A G 7: 83,646,559 V1134A probably damaging Het
Kcnn4 A G 7: 24,384,079 D395G probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Kif13a T C 13: 46,815,304 N354S probably damaging Het
Lrp1 C T 10: 127,574,455 R1474Q possibly damaging Het
Map3k9 T C 12: 81,734,114 Q424R probably damaging Het
Mkx A C 18: 6,992,784 S167A possibly damaging Het
Ms4a14 A G 19: 11,304,615 F193S possibly damaging Het
Myo18a A T 11: 77,845,401 D1508V probably damaging Het
Nek4 T A 14: 30,963,951 N273K probably benign Het
Nipal3 A T 4: 135,452,398 V403D possibly damaging Het
Nlrp6 G A 7: 140,923,255 V425M probably damaging Het
Olfr1228 T A 2: 89,249,308 M117L possibly damaging Het
Olfr127 A G 17: 37,904,359 D271G probably damaging Het
Olfr1342 A T 4: 118,690,209 V81E possibly damaging Het
Olfr825 T C 10: 130,163,047 K93R probably benign Het
Otub1 A T 19: 7,204,429 D27E probably damaging Het
Pcnx2 T C 8: 125,768,301 D1607G probably damaging Het
Pde2a A G 7: 101,421,971 Y16C probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Prph2 A T 17: 46,919,966 M262L probably benign Het
Rnf10 A C 5: 115,251,379 I243S probably damaging Het
Samd9l T C 6: 3,375,549 I571V probably damaging Het
Scube1 C T 15: 83,659,088 G183D probably damaging Het
Sidt2 A G 9: 45,945,730 V426A probably benign Het
Slc20a1 T C 2: 129,209,121 L566P probably damaging Het
Slc22a3 A G 17: 12,423,732 probably null Het
Snx11 G T 11: 96,770,674 S168R probably benign Het
Snx5 T C 2: 144,255,562 N218D probably benign Het
Snx7 A T 3: 117,838,934 D169E probably benign Het
Soat1 A G 1: 156,446,610 L77P probably damaging Het
Sucnr1 T A 3: 60,086,741 V230E probably damaging Het
Supv3l1 T C 10: 62,429,503 K753E probably benign Het
Tango6 T G 8: 106,742,358 L829V possibly damaging Het
Tek T C 4: 94,827,670 V443A probably benign Het
Tet1 A T 10: 62,879,080 L312Q probably damaging Het
Tgm1 A T 14: 55,710,534 N269K probably damaging Het
Thrb A T 14: 18,008,645 D168V probably damaging Het
Tk2 C T 8: 104,231,172 V181I probably benign Het
Tm6sf2 T C 8: 70,074,322 L47P probably damaging Het
Tmcc3 T A 10: 94,579,216 M291K probably benign Het
Tnfrsf21 A G 17: 43,039,899 E318G probably benign Het
Ttc7 T C 17: 87,334,328 V451A probably benign Het
Ugt2b36 A T 5: 87,092,393 D44E probably benign Het
Usp17la G T 7: 104,860,931 V248L probably damaging Het
Utp20 A C 10: 88,752,948 I2453S probably benign Het
Wdr91 A T 6: 34,886,882 I566N possibly damaging Het
Zfp282 A G 6: 47,890,718 D276G probably benign Het
Zfp866 T C 8: 69,765,978 K331E probably benign Het
Zkscan17 A T 11: 59,503,584 W64R possibly damaging Het
Other mutations in Pxdn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Pxdn APN 12 29987099 missense probably damaging 1.00
IGL01152:Pxdn APN 12 30001937 missense probably damaging 0.99
IGL01286:Pxdn APN 12 29982754 missense probably benign 0.04
IGL01323:Pxdn APN 12 29987137 missense probably benign 0.00
IGL01338:Pxdn APN 12 30002797 missense probably damaging 1.00
IGL01341:Pxdn APN 12 30002487 missense probably damaging 1.00
IGL01401:Pxdn APN 12 30001984 missense probably damaging 1.00
IGL01580:Pxdn APN 12 29984493 missense probably benign 0.18
IGL01650:Pxdn APN 12 30002401 missense probably benign 0.01
IGL01679:Pxdn APN 12 29999902 missense probably damaging 0.97
IGL01866:Pxdn APN 12 29984571 missense probably benign 0.02
IGL02354:Pxdn APN 12 29999189 missense probably damaging 1.00
IGL02361:Pxdn APN 12 29999189 missense probably damaging 1.00
IGL02427:Pxdn APN 12 29984532 missense probably damaging 1.00
IGL02955:Pxdn APN 12 30003157 missense probably damaging 1.00
IGL03079:Pxdn APN 12 30002998 missense probably damaging 0.97
IGL03111:Pxdn APN 12 29982756 missense probably damaging 0.99
IGL02988:Pxdn UTSW 12 30003114 nonsense probably null
PIT4280001:Pxdn UTSW 12 29995328 missense probably damaging 0.99
PIT4469001:Pxdn UTSW 12 30005829 missense probably benign 0.00
R0070:Pxdn UTSW 12 29982727 missense probably damaging 0.99
R0070:Pxdn UTSW 12 29982727 missense probably damaging 0.99
R0086:Pxdn UTSW 12 30002419 missense possibly damaging 0.95
R0140:Pxdn UTSW 12 29982754 missense probably benign 0.04
R0201:Pxdn UTSW 12 30002431 missense possibly damaging 0.79
R0282:Pxdn UTSW 12 29984440 nonsense probably null
R0310:Pxdn UTSW 12 30015529 missense probably damaging 1.00
R0426:Pxdn UTSW 12 29987066 missense possibly damaging 0.89
R0468:Pxdn UTSW 12 29994486 missense probably damaging 0.99
R0825:Pxdn UTSW 12 29984996 splice site probably benign
R0885:Pxdn UTSW 12 30003402 missense probably benign 0.30
R1420:Pxdn UTSW 12 30002068 missense probably damaging 1.00
R1588:Pxdn UTSW 12 30002559 missense probably damaging 1.00
R2269:Pxdn UTSW 12 30005775 missense probably damaging 0.97
R2280:Pxdn UTSW 12 29984906 missense probably damaging 0.98
R2504:Pxdn UTSW 12 30003406 missense probably damaging 1.00
R2679:Pxdn UTSW 12 29975569 splice site probably benign
R3116:Pxdn UTSW 12 30002307 missense possibly damaging 0.89
R3607:Pxdn UTSW 12 29990918 missense probably benign 0.04
R4033:Pxdn UTSW 12 30003225 missense probably benign 0.19
R4576:Pxdn UTSW 12 30011923 missense probably benign
R4659:Pxdn UTSW 12 29994553 missense probably benign 0.01
R4681:Pxdn UTSW 12 30012326 missense probably benign 0.45
R4968:Pxdn UTSW 12 30000012 missense probably benign 0.25
R5032:Pxdn UTSW 12 30003141 missense probably benign 0.08
R5232:Pxdn UTSW 12 29990988 missense probably benign 0.08
R5366:Pxdn UTSW 12 30002900 missense probably damaging 1.00
R5504:Pxdn UTSW 12 30002801 missense probably damaging 1.00
R5586:Pxdn UTSW 12 30003142 missense probably damaging 0.99
R5739:Pxdn UTSW 12 29982334 missense probably benign 0.03
R5877:Pxdn UTSW 12 30003046 missense probably damaging 1.00
R6167:Pxdn UTSW 12 29974001 missense probably damaging 1.00
R6191:Pxdn UTSW 12 29982717 missense possibly damaging 0.94
R6200:Pxdn UTSW 12 30003112 missense probably damaging 1.00
R6609:Pxdn UTSW 12 30002941 missense probably benign 0.00
R6628:Pxdn UTSW 12 29999918 missense probably damaging 1.00
R6865:Pxdn UTSW 12 30014583 splice site probably null
R6921:Pxdn UTSW 12 30015505 missense probably damaging 0.96
R6995:Pxdn UTSW 12 29995371 missense possibly damaging 0.95
R7211:Pxdn UTSW 12 29984904 missense possibly damaging 0.77
R7220:Pxdn UTSW 12 29994480 missense probably benign 0.02
R7347:Pxdn UTSW 12 30012261 missense probably benign 0.01
R7402:Pxdn UTSW 12 30002439 missense probably damaging 1.00
R7408:Pxdn UTSW 12 29990945 missense probably benign 0.29
R7413:Pxdn UTSW 12 30002928 missense probably benign 0.00
R7447:Pxdn UTSW 12 29984927 missense probably damaging 1.00
R7572:Pxdn UTSW 12 30006705 missense probably damaging 1.00
R7708:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R7815:Pxdn UTSW 12 30005825 missense probably damaging 0.96
R7972:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8097:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8205:Pxdn UTSW 12 30006567 missense probably damaging 1.00
R8262:Pxdn UTSW 12 29999196 nonsense probably null
R8335:Pxdn UTSW 12 30002097 missense probably damaging 0.99
R8356:Pxdn UTSW 12 30011890 missense probably damaging 0.99
R8437:Pxdn UTSW 12 30002044 missense probably damaging 1.00
R8456:Pxdn UTSW 12 30011890 missense probably damaging 0.99
R8709:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8772:Pxdn UTSW 12 30015464 missense probably damaging 1.00
Z1177:Pxdn UTSW 12 29990852 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGCTAACTGAATCCATGATTTC -3'
(R):5'- ACAATTCCCACAACGAGGGG -3'

Sequencing Primer
(F):5'- CTGAATCCATGATTTCCATATTGGC -3'
(R):5'- CGTTCTCAGGCAAAGCAGCAG -3'
Posted On2020-06-30