Incidental Mutation 'R8098:Exoc3'
ID630347
Institutional Source Beutler Lab
Gene Symbol Exoc3
Ensembl Gene ENSMUSG00000034152
Gene Nameexocyst complex component 3
SynonymsSec6l1, E430013E20Rik, 2810050O03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R8098 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location74169488-74208732 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74172152 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 730 (M730T)
Ref Sequence ENSEMBL: ENSMUSP00000039416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035934] [ENSMUST00000221703] [ENSMUST00000225423]
Predicted Effect probably benign
Transcript: ENSMUST00000035934
AA Change: M730T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039416
Gene: ENSMUSG00000034152
AA Change: M730T

DomainStartEndE-ValueType
Pfam:Sec6 187 743 1.7e-162 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221703
Predicted Effect probably benign
Transcript: ENSMUST00000225423
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multiple protein complex essential for targeting exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and functions of exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. The complex is also essential for the biogenesis of epithelial cell surface polarity. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik A T 18: 57,667,331 I185L probably benign Het
3425401B19Rik A G 14: 32,662,661 L449P probably damaging Het
4931440F15Rik A G 11: 29,824,450 S336P possibly damaging Het
Abca15 A G 7: 120,361,396 S694G probably benign Het
Abcc6 A G 7: 45,996,665 L800P probably damaging Het
Adam15 T A 3: 89,343,886 D504V probably damaging Het
Adnp T C 2: 168,182,532 T948A probably benign Het
Akap11 T C 14: 78,512,922 D675G Het
Atp13a3 A C 16: 30,354,297 V254G possibly damaging Het
Atp1a1 A G 3: 101,582,049 I749T probably damaging Het
B3glct T A 5: 149,750,500 Y369* probably null Het
Bms1 C T 6: 118,384,258 R1204H probably damaging Het
Btla T A 16: 45,244,249 L188* probably null Het
Btn2a2 A G 13: 23,481,888 V258A probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Cacna1g T C 11: 94,416,512 H1782R probably benign Het
Calcoco1 T C 15: 102,716,324 D172G probably benign Het
Ciart G A 3: 95,881,344 P61L probably damaging Het
Ckap4 A G 10: 84,533,635 S78P probably damaging Het
Col6a3 A T 1: 90,803,661 D1623E probably benign Het
Col7a1 A G 9: 108,956,695 T411A unknown Het
Cpt1a A C 19: 3,370,849 I436L probably benign Het
Cyp2c23 T A 19: 44,015,803 I173F probably benign Het
Dcun1d2 T C 8: 13,261,396 T198A probably benign Het
Ddx50 A C 10: 62,625,143 probably null Het
Depdc1b A G 13: 108,324,059 T68A probably damaging Het
Dgkq G A 5: 108,652,468 R546W probably damaging Het
Dmbt1 G A 7: 131,108,459 W1493* probably null Het
Dnah17 A G 11: 118,050,367 S3219P probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Egf T A 3: 129,690,837 Y986F probably benign Het
Ell3 TCTCCTC TCTC 2: 121,439,456 probably benign Het
Ep400 A T 5: 110,693,251 M1805K unknown Het
Fbxl13 T A 5: 21,620,718 M129L probably benign Het
Gins4 T A 8: 23,237,021 M19L probably benign Het
Gm3238 T C 10: 77,770,640 N229S unknown Het
Gpd2 T A 2: 57,290,008 V89D possibly damaging Het
Hectd4 G A 5: 121,321,398 V777I possibly damaging Het
Hgf T A 5: 16,561,061 V65E probably benign Het
Hnrnpdl A G 5: 100,037,920 S169P probably benign Het
Igfbp3 T C 11: 7,210,104 D183G possibly damaging Het
Il16 A G 7: 83,646,559 V1134A probably damaging Het
Kcnn4 A G 7: 24,384,079 D395G probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Kif13a T C 13: 46,815,304 N354S probably damaging Het
Lrp1 C T 10: 127,574,455 R1474Q possibly damaging Het
Map3k9 T C 12: 81,734,114 Q424R probably damaging Het
Mkx A C 18: 6,992,784 S167A possibly damaging Het
Ms4a14 A G 19: 11,304,615 F193S possibly damaging Het
Myo18a A T 11: 77,845,401 D1508V probably damaging Het
Nek4 T A 14: 30,963,951 N273K probably benign Het
Nipal3 A T 4: 135,452,398 V403D possibly damaging Het
Nlrp6 G A 7: 140,923,255 V425M probably damaging Het
Olfr1228 T A 2: 89,249,308 M117L possibly damaging Het
Olfr127 A G 17: 37,904,359 D271G probably damaging Het
Olfr1342 A T 4: 118,690,209 V81E possibly damaging Het
Olfr825 T C 10: 130,163,047 K93R probably benign Het
Otub1 A T 19: 7,204,429 D27E probably damaging Het
Pcnx2 T C 8: 125,768,301 D1607G probably damaging Het
Pde2a A G 7: 101,421,971 Y16C probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Prph2 A T 17: 46,919,966 M262L probably benign Het
Pxdn C T 12: 30,006,602 L1271F probably damaging Het
Rnf10 A C 5: 115,251,379 I243S probably damaging Het
Samd9l T C 6: 3,375,549 I571V probably damaging Het
Scube1 C T 15: 83,659,088 G183D probably damaging Het
Sidt2 A G 9: 45,945,730 V426A probably benign Het
Slc20a1 T C 2: 129,209,121 L566P probably damaging Het
Slc22a3 A G 17: 12,423,732 probably null Het
Snx11 G T 11: 96,770,674 S168R probably benign Het
Snx5 T C 2: 144,255,562 N218D probably benign Het
Snx7 A T 3: 117,838,934 D169E probably benign Het
Soat1 A G 1: 156,446,610 L77P probably damaging Het
Sucnr1 T A 3: 60,086,741 V230E probably damaging Het
Supv3l1 T C 10: 62,429,503 K753E probably benign Het
Tango6 T G 8: 106,742,358 L829V possibly damaging Het
Tek T C 4: 94,827,670 V443A probably benign Het
Tet1 A T 10: 62,879,080 L312Q probably damaging Het
Tgm1 A T 14: 55,710,534 N269K probably damaging Het
Thrb A T 14: 18,008,645 D168V probably damaging Het
Tk2 C T 8: 104,231,172 V181I probably benign Het
Tm6sf2 T C 8: 70,074,322 L47P probably damaging Het
Tmcc3 T A 10: 94,579,216 M291K probably benign Het
Tnfrsf21 A G 17: 43,039,899 E318G probably benign Het
Ttc7 T C 17: 87,334,328 V451A probably benign Het
Ugt2b36 A T 5: 87,092,393 D44E probably benign Het
Usp17la G T 7: 104,860,931 V248L probably damaging Het
Utp20 A C 10: 88,752,948 I2453S probably benign Het
Wdr91 A T 6: 34,886,882 I566N possibly damaging Het
Zfp282 A G 6: 47,890,718 D276G probably benign Het
Zfp866 T C 8: 69,765,978 K331E probably benign Het
Zkscan17 A T 11: 59,503,584 W64R possibly damaging Het
Other mutations in Exoc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00695:Exoc3 APN 13 74206906 critical splice donor site probably null
IGL01444:Exoc3 APN 13 74206935 missense probably damaging 1.00
IGL02095:Exoc3 APN 13 74180536 missense probably damaging 1.00
IGL02370:Exoc3 APN 13 74192761 missense probably benign 0.02
IGL02704:Exoc3 APN 13 74174144 missense probably benign 0.00
IGL03113:Exoc3 APN 13 74193113 nonsense probably null
R0037:Exoc3 UTSW 13 74199539 missense probably damaging 0.99
R0565:Exoc3 UTSW 13 74182275 critical splice donor site probably null
R1282:Exoc3 UTSW 13 74182292 missense probably benign 0.30
R1438:Exoc3 UTSW 13 74190179 missense probably damaging 1.00
R1694:Exoc3 UTSW 13 74190065 splice site probably null
R1913:Exoc3 UTSW 13 74182316 missense probably damaging 1.00
R1915:Exoc3 UTSW 13 74173294 critical splice donor site probably null
R2039:Exoc3 UTSW 13 74192977 missense probably benign
R4272:Exoc3 UTSW 13 74192644 missense probably damaging 1.00
R4852:Exoc3 UTSW 13 74199645 missense probably damaging 1.00
R5698:Exoc3 UTSW 13 74174015 missense probably benign 0.13
R5909:Exoc3 UTSW 13 74199524 missense probably damaging 0.98
R5969:Exoc3 UTSW 13 74172186 nonsense probably null
R6248:Exoc3 UTSW 13 74182281 missense probably benign 0.40
R6433:Exoc3 UTSW 13 74189187 missense possibly damaging 0.93
R6599:Exoc3 UTSW 13 74189158 splice site probably null
R6861:Exoc3 UTSW 13 74189200 missense probably benign
R7000:Exoc3 UTSW 13 74182166 missense probably benign 0.41
R7384:Exoc3 UTSW 13 74172156 missense probably benign 0.00
R8146:Exoc3 UTSW 13 74192665 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTAGAGAACAGTGTGATGCCAC -3'
(R):5'- AAGAGATGTTCTTTGTAGCTCTGAG -3'

Sequencing Primer
(F):5'- GACAGGAACATGTAACTGACATC -3'
(R):5'- TCTGAGTGTCACCAGTGGAGAC -3'
Posted On2020-06-30