Incidental Mutation 'R8098:Cpt1a'
ID630366
Institutional Source Beutler Lab
Gene Symbol Cpt1a
Ensembl Gene ENSMUSG00000024900
Gene Namecarnitine palmitoyltransferase 1a, liver
SynonymsL-CPT I, CPTI, Cpt1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8098 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location3323301-3385732 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 3370849 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 436 (I436L)
Ref Sequence ENSEMBL: ENSMUSP00000025835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025835]
Predicted Effect probably benign
Transcript: ENSMUST00000025835
AA Change: I436L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025835
Gene: ENSMUSG00000024900
AA Change: I436L

DomainStartEndE-ValueType
Pfam:CPT_N 1 47 2.3e-30 PFAM
transmembrane domain 49 71 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
Pfam:Carn_acyltransf 171 762 6e-186 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The mitochondrial oxidation of long-chain fatty acids is initiated by the sequential action of carnitine palmitoyltransferase I (which is located in the outer membrane and is detergent-labile) and carnitine palmitoyltransferase II (which is located in the inner membrane and is detergent-stable), together with a carnitine-acylcarnitine translocase. CPT I is the key enzyme in the carnitine-dependent transport across the mitochondrial inner membrane and its deficiency results in a decreased rate of fatty acid beta-oxidation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality. Heterozygous null mice display decreased serum glucose and increased serum free fatty acid levels after fasting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik A T 18: 57,667,331 I185L probably benign Het
3425401B19Rik A G 14: 32,662,661 L449P probably damaging Het
4931440F15Rik A G 11: 29,824,450 S336P possibly damaging Het
Abca15 A G 7: 120,361,396 S694G probably benign Het
Abcc6 A G 7: 45,996,665 L800P probably damaging Het
Adam15 T A 3: 89,343,886 D504V probably damaging Het
Adnp T C 2: 168,182,532 T948A probably benign Het
Akap11 T C 14: 78,512,922 D675G Het
Atp13a3 A C 16: 30,354,297 V254G possibly damaging Het
Atp1a1 A G 3: 101,582,049 I749T probably damaging Het
B3glct T A 5: 149,750,500 Y369* probably null Het
Bms1 C T 6: 118,384,258 R1204H probably damaging Het
Btla T A 16: 45,244,249 L188* probably null Het
Btn2a2 A G 13: 23,481,888 V258A probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Cacna1g T C 11: 94,416,512 H1782R probably benign Het
Calcoco1 T C 15: 102,716,324 D172G probably benign Het
Ciart G A 3: 95,881,344 P61L probably damaging Het
Ckap4 A G 10: 84,533,635 S78P probably damaging Het
Col6a3 A T 1: 90,803,661 D1623E probably benign Het
Col7a1 A G 9: 108,956,695 T411A unknown Het
Cyp2c23 T A 19: 44,015,803 I173F probably benign Het
Dcun1d2 T C 8: 13,261,396 T198A probably benign Het
Ddx50 A C 10: 62,625,143 probably null Het
Depdc1b A G 13: 108,324,059 T68A probably damaging Het
Dgkq G A 5: 108,652,468 R546W probably damaging Het
Dmbt1 G A 7: 131,108,459 W1493* probably null Het
Dnah17 A G 11: 118,050,367 S3219P probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Egf T A 3: 129,690,837 Y986F probably benign Het
Ell3 TCTCCTC TCTC 2: 121,439,456 probably benign Het
Ep400 A T 5: 110,693,251 M1805K unknown Het
Exoc3 A G 13: 74,172,152 M730T probably benign Het
Fbxl13 T A 5: 21,620,718 M129L probably benign Het
Gins4 T A 8: 23,237,021 M19L probably benign Het
Gm3238 T C 10: 77,770,640 N229S unknown Het
Gpd2 T A 2: 57,290,008 V89D possibly damaging Het
Hectd4 G A 5: 121,321,398 V777I possibly damaging Het
Hgf T A 5: 16,561,061 V65E probably benign Het
Hnrnpdl A G 5: 100,037,920 S169P probably benign Het
Igfbp3 T C 11: 7,210,104 D183G possibly damaging Het
Il16 A G 7: 83,646,559 V1134A probably damaging Het
Kcnn4 A G 7: 24,384,079 D395G probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Kif13a T C 13: 46,815,304 N354S probably damaging Het
Lrp1 C T 10: 127,574,455 R1474Q possibly damaging Het
Map3k9 T C 12: 81,734,114 Q424R probably damaging Het
Mkx A C 18: 6,992,784 S167A possibly damaging Het
Ms4a14 A G 19: 11,304,615 F193S possibly damaging Het
Myo18a A T 11: 77,845,401 D1508V probably damaging Het
Nek4 T A 14: 30,963,951 N273K probably benign Het
Nipal3 A T 4: 135,452,398 V403D possibly damaging Het
Nlrp6 G A 7: 140,923,255 V425M probably damaging Het
Olfr1228 T A 2: 89,249,308 M117L possibly damaging Het
Olfr127 A G 17: 37,904,359 D271G probably damaging Het
Olfr1342 A T 4: 118,690,209 V81E possibly damaging Het
Olfr825 T C 10: 130,163,047 K93R probably benign Het
Otub1 A T 19: 7,204,429 D27E probably damaging Het
Pcnx2 T C 8: 125,768,301 D1607G probably damaging Het
Pde2a A G 7: 101,421,971 Y16C probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Prph2 A T 17: 46,919,966 M262L probably benign Het
Pxdn C T 12: 30,006,602 L1271F probably damaging Het
Rnf10 A C 5: 115,251,379 I243S probably damaging Het
Samd9l T C 6: 3,375,549 I571V probably damaging Het
Scube1 C T 15: 83,659,088 G183D probably damaging Het
Sidt2 A G 9: 45,945,730 V426A probably benign Het
Slc20a1 T C 2: 129,209,121 L566P probably damaging Het
Slc22a3 A G 17: 12,423,732 probably null Het
Snx11 G T 11: 96,770,674 S168R probably benign Het
Snx5 T C 2: 144,255,562 N218D probably benign Het
Snx7 A T 3: 117,838,934 D169E probably benign Het
Soat1 A G 1: 156,446,610 L77P probably damaging Het
Sucnr1 T A 3: 60,086,741 V230E probably damaging Het
Supv3l1 T C 10: 62,429,503 K753E probably benign Het
Tango6 T G 8: 106,742,358 L829V possibly damaging Het
Tek T C 4: 94,827,670 V443A probably benign Het
Tet1 A T 10: 62,879,080 L312Q probably damaging Het
Tgm1 A T 14: 55,710,534 N269K probably damaging Het
Thrb A T 14: 18,008,645 D168V probably damaging Het
Tk2 C T 8: 104,231,172 V181I probably benign Het
Tm6sf2 T C 8: 70,074,322 L47P probably damaging Het
Tmcc3 T A 10: 94,579,216 M291K probably benign Het
Tnfrsf21 A G 17: 43,039,899 E318G probably benign Het
Ttc7 T C 17: 87,334,328 V451A probably benign Het
Ugt2b36 A T 5: 87,092,393 D44E probably benign Het
Usp17la G T 7: 104,860,931 V248L probably damaging Het
Utp20 A C 10: 88,752,948 I2453S probably benign Het
Wdr91 A T 6: 34,886,882 I566N possibly damaging Het
Zfp282 A G 6: 47,890,718 D276G probably benign Het
Zfp866 T C 8: 69,765,978 K331E probably benign Het
Zkscan17 A T 11: 59,503,584 W64R possibly damaging Het
Other mutations in Cpt1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Cpt1a APN 19 3366389 missense possibly damaging 0.85
allosouris UTSW 19 3378472 missense probably damaging 1.00
Tyrannosouris UTSW 19 3362156 missense probably damaging 1.00
R0029:Cpt1a UTSW 19 3381674 missense probably benign 0.04
R0029:Cpt1a UTSW 19 3381674 missense probably benign 0.04
R0305:Cpt1a UTSW 19 3378455 missense probably benign
R0963:Cpt1a UTSW 19 3381634 missense probably damaging 1.00
R1511:Cpt1a UTSW 19 3365788 splice site probably benign
R2102:Cpt1a UTSW 19 3371585 missense probably benign 0.25
R3034:Cpt1a UTSW 19 3378390 missense probably damaging 1.00
R3153:Cpt1a UTSW 19 3356430 missense probably damaging 0.99
R5195:Cpt1a UTSW 19 3383800 missense possibly damaging 0.88
R5391:Cpt1a UTSW 19 3349260 missense probably damaging 0.98
R5964:Cpt1a UTSW 19 3365760 missense possibly damaging 0.80
R6031:Cpt1a UTSW 19 3371556 splice site probably null
R6031:Cpt1a UTSW 19 3371556 splice site probably null
R6246:Cpt1a UTSW 19 3376550 missense probably damaging 0.99
R6339:Cpt1a UTSW 19 3362152 missense probably benign 0.27
R6427:Cpt1a UTSW 19 3362156 missense probably damaging 1.00
R6535:Cpt1a UTSW 19 3365788 splice site probably null
R6621:Cpt1a UTSW 19 3378472 missense probably damaging 1.00
R6892:Cpt1a UTSW 19 3371660 missense probably benign 0.00
R7142:Cpt1a UTSW 19 3375100 missense probably benign 0.00
R7385:Cpt1a UTSW 19 3380155 missense probably damaging 0.99
R7908:Cpt1a UTSW 19 3362202 missense probably benign 0.26
R8362:Cpt1a UTSW 19 3370744 nonsense probably null
R8444:Cpt1a UTSW 19 3381981 missense probably benign
X0019:Cpt1a UTSW 19 3366348 missense probably benign 0.01
Z1177:Cpt1a UTSW 19 3366370 missense probably damaging 1.00
Z1177:Cpt1a UTSW 19 3370727 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATGCGTTTACTCCTTGCC -3'
(R):5'- ACCCACAGTTAAGAAGGGTG -3'

Sequencing Primer
(F):5'- ACTCCTTGCCACAGAGTGC -3'
(R):5'- GGCCTACAACTGTGTCTGAG -3'
Posted On2020-06-30