Incidental Mutation 'R8099:Olfr1154'
ID630372
Institutional Source Beutler Lab
Gene Symbol Olfr1154
Ensembl Gene ENSMUSG00000075146
Gene Nameolfactory receptor 1154
SynonymsGA_x6K02T2Q125-49403456-49402524, MOR173-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R8099 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location87901256-87905166 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87903508 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 56 (H56L)
Ref Sequence ENSEMBL: ENSMUSP00000148909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099844] [ENSMUST00000215017] [ENSMUST00000215862]
Predicted Effect probably damaging
Transcript: ENSMUST00000099844
AA Change: H56L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097432
Gene: ENSMUSG00000075146
AA Change: H56L

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 8.1e-47 PFAM
Pfam:7tm_1 41 289 3.6e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215017
AA Change: H56L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215862
AA Change: H56L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.1%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik T C 14: 70,157,520 R62G probably benign Het
Abcb9 A G 5: 124,077,245 F478L probably benign Het
Abcc9 A T 6: 142,675,531 N494K probably damaging Het
Atp11a T G 8: 12,861,973 M124R Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Ccdc110 T A 8: 45,942,093 H340Q probably damaging Het
Celsr1 A G 15: 86,031,600 L724P probably damaging Het
Cfap74 A G 4: 155,455,032 N938S unknown Het
Chil3 T G 3: 106,148,668 D363A probably damaging Het
Ciart G A 3: 95,881,344 P61L probably damaging Het
Cpne3 A G 4: 19,525,169 V442A possibly damaging Het
Ctsh T C 9: 90,064,247 V130A probably damaging Het
Cyp3a44 T C 5: 145,788,402 K330E probably benign Het
Dgcr2 A T 16: 17,849,769 D275E probably damaging Het
Dnah1 A T 14: 31,302,364 D919E probably benign Het
Ell3 TCTCCTC TCTC 2: 121,439,456 probably benign Het
Epb41l3 T A 17: 69,247,688 F261Y possibly damaging Het
Fam189b T C 3: 89,183,943 F74L probably damaging Het
Fbxo3 A C 2: 104,054,935 H383P probably damaging Het
Foxp1 C T 6: 98,945,549 V441M unknown Het
Gm29106 C T 1: 118,198,791 S71F probably benign Het
Golga3 T A 5: 110,188,707 L364* probably null Het
Herc1 T A 9: 66,372,140 L110H probably damaging Het
Hist1h1a C T 13: 23,763,849 L45F probably damaging Het
Igkv4-53 A T 6: 69,648,914 S90T possibly damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Kti12 G T 4: 108,848,374 G162W probably damaging Het
Lama3 T A 18: 12,534,063 I763N probably damaging Het
Macf1 A T 4: 123,476,129 I1613K probably benign Het
Mkrn1 T C 6: 39,410,097 D102G probably benign Het
Muc2 T A 7: 141,745,438 probably null Het
Nipal4 T C 11: 46,162,021 E39G probably benign Het
Nr1h2 T C 7: 44,550,322 Y391C possibly damaging Het
Odam T C 5: 87,892,440 I255T possibly damaging Het
Olfr279 A G 15: 98,497,813 M114V probably benign Het
Olfr781 T A 10: 129,333,127 I82K probably damaging Het
Per3 A T 4: 151,012,557 M837K possibly damaging Het
Pitpnm3 T A 11: 72,070,318 H357L possibly damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Plcb1 T C 2: 135,251,734 Y156H possibly damaging Het
Ppm1d C T 11: 85,339,666 P370L possibly damaging Het
Prrc2b T C 2: 32,208,674 V666A probably benign Het
Ptpn3 A T 4: 57,204,985 C725* probably null Het
Rapgefl1 T C 11: 98,847,383 W437R probably damaging Het
Sema4g T C 19: 44,992,528 L5P probably damaging Het
Sipa1l1 C T 12: 82,433,826 P1529L probably benign Het
Slc12a2 T C 18: 57,899,392 L388P probably damaging Het
Sltm T A 9: 70,586,078 S786T probably damaging Het
Srsf1 T C 11: 88,049,256 I198T probably benign Het
Ssh2 C T 11: 77,454,929 R1247* probably null Het
Ssu2 T C 6: 112,376,477 T229A probably benign Het
Stra6 T A 9: 58,152,494 H579Q probably damaging Het
Tanc2 T A 11: 105,864,007 V559E probably benign Het
Trp53bp1 A G 2: 121,199,749 Y1762H probably damaging Het
Usp15 T C 10: 123,146,921 Y263C possibly damaging Het
Usp17ld A T 7: 103,250,288 V479E probably damaging Het
Vmn2r15 A T 5: 109,293,319 S224R possibly damaging Het
Vmn2r8 A T 5: 108,801,834 N382K probably benign Het
Vmn2r94 T C 17: 18,257,397 I251V probably benign Het
Wnt2b A T 3: 104,947,092 V350D possibly damaging Het
Other mutations in Olfr1154
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Olfr1154 APN 2 87903527 missense probably benign 0.00
IGL01878:Olfr1154 APN 2 87903331 nonsense probably null
IGL02683:Olfr1154 APN 2 87903104 missense possibly damaging 0.80
IGL02836:Olfr1154 APN 2 87903380 missense possibly damaging 0.81
R0432:Olfr1154 UTSW 2 87902960 missense probably damaging 1.00
R1123:Olfr1154 UTSW 2 87902904 missense probably damaging 0.99
R1223:Olfr1154 UTSW 2 87902819 missense probably damaging 0.99
R1561:Olfr1154 UTSW 2 87903161 missense probably benign 0.00
R1964:Olfr1154 UTSW 2 87903667 missense probably benign 0.00
R2041:Olfr1154 UTSW 2 87902797 missense probably damaging 1.00
R2219:Olfr1154 UTSW 2 87902925 nonsense probably null
R2233:Olfr1154 UTSW 2 87903475 missense probably damaging 1.00
R3719:Olfr1154 UTSW 2 87903103 missense probably benign 0.05
R4826:Olfr1154 UTSW 2 87903349 missense probably damaging 1.00
R4908:Olfr1154 UTSW 2 87903189 missense probably damaging 1.00
R5056:Olfr1154 UTSW 2 87903571 missense probably damaging 1.00
R5589:Olfr1154 UTSW 2 87903347 missense probably benign 0.26
R6477:Olfr1154 UTSW 2 87902990 missense probably damaging 1.00
R6532:Olfr1154 UTSW 2 87903202 missense probably damaging 1.00
R6666:Olfr1154 UTSW 2 87903508 missense probably damaging 1.00
R6693:Olfr1154 UTSW 2 87903308 missense probably damaging 1.00
R6724:Olfr1154 UTSW 2 87903602 missense probably benign 0.00
R7784:Olfr1154 UTSW 2 87903193 missense probably benign 0.01
R8168:Olfr1154 UTSW 2 87903199 missense probably damaging 0.97
Z1088:Olfr1154 UTSW 2 87903584 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TGTACCTGTCATAAGCCATGGC -3'
(R):5'- GGGCTACAGAAACCAAAATTTCTAC -3'

Sequencing Primer
(F):5'- CAGCCAAAAGGAAAGATTCTGTATC -3'
(R):5'- TTCTACAAATAATGAGTGTGGAGAAC -3'
Posted On2020-06-30