Incidental Mutation 'R8099:Kti12'
ID630383
Institutional Source Beutler Lab
Gene Symbol Kti12
Ensembl Gene ENSMUSG00000073775
Gene NameKTI12 homolog, chromatin associated
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8099 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location108847785-108849413 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 108848374 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 162 (G162W)
Ref Sequence ENSEMBL: ENSMUSP00000099799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030296] [ENSMUST00000102738] [ENSMUST00000164855]
Predicted Effect probably benign
Transcript: ENSMUST00000030296
SMART Domains Protein: ENSMUSP00000030296
Gene: ENSMUSG00000028567

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
Pfam:Thioredoxin_7 37 118 1.1e-19 PFAM
Pfam:Thioredoxin 41 135 1.9e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102738
AA Change: G162W

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099799
Gene: ENSMUSG00000073775
AA Change: G162W

DomainStartEndE-ValueType
Pfam:KTI12 1 347 3.3e-107 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164855
SMART Domains Protein: ENSMUSP00000128780
Gene: ENSMUSG00000090551

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
low complexity region 47 64 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik T C 14: 70,157,520 R62G probably benign Het
Abcb9 A G 5: 124,077,245 F478L probably benign Het
Abcc9 A T 6: 142,675,531 N494K probably damaging Het
Atp11a T G 8: 12,861,973 M124R Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Ccdc110 T A 8: 45,942,093 H340Q probably damaging Het
Celsr1 A G 15: 86,031,600 L724P probably damaging Het
Cfap74 A G 4: 155,455,032 N938S unknown Het
Chil3 T G 3: 106,148,668 D363A probably damaging Het
Ciart G A 3: 95,881,344 P61L probably damaging Het
Cpne3 A G 4: 19,525,169 V442A possibly damaging Het
Ctsh T C 9: 90,064,247 V130A probably damaging Het
Cyp3a44 T C 5: 145,788,402 K330E probably benign Het
Dgcr2 A T 16: 17,849,769 D275E probably damaging Het
Dnah1 A T 14: 31,302,364 D919E probably benign Het
Ell3 TCTCCTC TCTC 2: 121,439,456 probably benign Het
Epb41l3 T A 17: 69,247,688 F261Y possibly damaging Het
Fam189b T C 3: 89,183,943 F74L probably damaging Het
Fbxo3 A C 2: 104,054,935 H383P probably damaging Het
Foxp1 C T 6: 98,945,549 V441M unknown Het
Gm29106 C T 1: 118,198,791 S71F probably benign Het
Golga3 T A 5: 110,188,707 L364* probably null Het
Herc1 T A 9: 66,372,140 L110H probably damaging Het
Hist1h1a C T 13: 23,763,849 L45F probably damaging Het
Igkv4-53 A T 6: 69,648,914 S90T possibly damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Lama3 T A 18: 12,534,063 I763N probably damaging Het
Macf1 A T 4: 123,476,129 I1613K probably benign Het
Mkrn1 T C 6: 39,410,097 D102G probably benign Het
Nipal4 T C 11: 46,162,021 E39G probably benign Het
Nr1h2 T C 7: 44,550,322 Y391C possibly damaging Het
Odam T C 5: 87,892,440 I255T possibly damaging Het
Olfr1154 T A 2: 87,903,508 H56L probably damaging Het
Olfr279 A G 15: 98,497,813 M114V probably benign Het
Olfr781 T A 10: 129,333,127 I82K probably damaging Het
Per3 A T 4: 151,012,557 M837K possibly damaging Het
Pitpnm3 T A 11: 72,070,318 H357L possibly damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Plcb1 T C 2: 135,251,734 Y156H possibly damaging Het
Ppm1d C T 11: 85,339,666 P370L possibly damaging Het
Prrc2b T C 2: 32,208,674 V666A probably benign Het
Ptpn3 A T 4: 57,204,985 C725* probably null Het
Rapgefl1 T C 11: 98,847,383 W437R probably damaging Het
Sema4g T C 19: 44,992,528 L5P probably damaging Het
Sipa1l1 C T 12: 82,433,826 P1529L probably benign Het
Slc12a2 T C 18: 57,899,392 L388P probably damaging Het
Sltm T A 9: 70,586,078 S786T probably damaging Het
Srsf1 T C 11: 88,049,256 I198T probably benign Het
Ssh2 C T 11: 77,454,929 R1247* probably null Het
Ssu2 T C 6: 112,376,477 T229A probably benign Het
Stra6 T A 9: 58,152,494 H579Q probably damaging Het
Tanc2 T A 11: 105,864,007 V559E probably benign Het
Trp53bp1 A G 2: 121,199,749 Y1762H probably damaging Het
Usp15 T C 10: 123,146,921 Y263C possibly damaging Het
Usp17ld A T 7: 103,250,288 V479E probably damaging Het
Vmn2r125 T C 4: 156,351,176 I283T possibly damaging Het
Vmn2r15 A T 5: 109,293,319 S224R possibly damaging Het
Vmn2r8 A T 5: 108,801,834 N382K probably benign Het
Vmn2r94 T C 17: 18,257,397 I251V probably benign Het
Wnt2b A T 3: 104,947,092 V350D possibly damaging Het
Other mutations in Kti12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02608:Kti12 APN 4 108848162 missense probably damaging 1.00
IGL02891:Kti12 APN 4 108848533 missense probably benign
IGL03142:Kti12 APN 4 108848165 missense probably damaging 1.00
BB002:Kti12 UTSW 4 108848246 missense probably benign
BB002:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB003:Kti12 UTSW 4 108848246 missense probably benign
BB003:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB004:Kti12 UTSW 4 108848246 missense probably benign
BB004:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB006:Kti12 UTSW 4 108848246 missense probably benign
BB006:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB012:Kti12 UTSW 4 108848246 missense probably benign
BB012:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB013:Kti12 UTSW 4 108848246 missense probably benign
BB013:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB014:Kti12 UTSW 4 108848246 missense probably benign
BB014:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB016:Kti12 UTSW 4 108848246 missense probably benign
BB016:Kti12 UTSW 4 108848247 missense probably benign 0.00
R0518:Kti12 UTSW 4 108848579 missense possibly damaging 0.95
R1681:Kti12 UTSW 4 108848858 missense probably damaging 1.00
R5510:Kti12 UTSW 4 108848624 missense probably damaging 1.00
R5522:Kti12 UTSW 4 108848423 missense possibly damaging 0.58
R6652:Kti12 UTSW 4 108848533 missense probably benign 0.00
R6774:Kti12 UTSW 4 108848455 missense probably benign 0.12
R7123:Kti12 UTSW 4 108848482 missense probably benign 0.00
R7856:Kti12 UTSW 4 108848246 missense probably benign
R7856:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7858:Kti12 UTSW 4 108848246 missense probably benign
R7858:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7859:Kti12 UTSW 4 108848246 missense probably benign
R7859:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7939:Kti12 UTSW 4 108848246 missense probably benign
R7939:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7941:Kti12 UTSW 4 108848246 missense probably benign
R7941:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7942:Kti12 UTSW 4 108848246 missense probably benign
R7942:Kti12 UTSW 4 108848247 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCTTACTTTACTGCGTGCG -3'
(R):5'- GGCAATGGCTCTTCTAAACCCAC -3'

Sequencing Primer
(F):5'- TGTCAGCGTGAGCTGGAGA -3'
(R):5'- CAGTGAACAAGGGGCGATCC -3'
Posted On2020-06-30