Mutagenetix > Incidental Mutation

Incidental Mutation 'R0702:Col5a2'

63039

Institutional Source

Beutler Lab

Gene Symbol

Col5a2

Ensembl Gene

ENSMUSG00000026042

Gene Name

collagen, type V, alpha 2

Synonyms

1110014L14Rik

MMRRC Submission

038885-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0702 (G1)

Quality Score

Status

Not validated

Chromosome

Chromosomal Location

45413491-45542442 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 45419291 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 1263 (D1263V)

Ref Sequence

ENSEMBL: ENSMUSP00000083620 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000086430]

AlphaFold

Q3U962

Predicted Effect

possibly damaging
Transcript: ENSMUST00000086430
AA Change: D1263V

PolyPhen 2 Score 0.544 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000083620
Gene: ENSMUSG00000026042
AA Change: D1263V

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
VWC	40	95	9.94e-23	SMART
Pfam:Collagen	123	186	1.5e-10	PFAM
Pfam:Collagen	207	272	2.9e-9	PFAM
low complexity region	319	347	N/A	INTRINSIC
internal_repeat_1	349	421	3.18e-18	PROSPERO
internal_repeat_2	385	422	1.34e-12	PROSPERO
internal_repeat_5	388	423	1.55e-7	PROSPERO
low complexity region	424	460	N/A	INTRINSIC
low complexity region	471	508	N/A	INTRINSIC
internal_repeat_6	509	535	5.68e-7	PROSPERO
internal_repeat_2	511	548	1.34e-12	PROSPERO
internal_repeat_3	520	549	1.16e-11	PROSPERO
internal_repeat_1	520	571	3.18e-18	PROSPERO
internal_repeat_4	546	574	4.91e-9	PROSPERO
low complexity region	595	611	N/A	INTRINSIC
internal_repeat_7	616	741	1.35e-6	PROSPERO
low complexity region	742	757	N/A	INTRINSIC
Pfam:Collagen	790	870	4.8e-8	PFAM
low complexity region	877	898	N/A	INTRINSIC
Pfam:Collagen	907	979	4.2e-8	PFAM
internal_repeat_4	993	1021	4.91e-9	PROSPERO
internal_repeat_3	994	1023	1.16e-11	PROSPERO
low complexity region	1024	1054	N/A	INTRINSIC
internal_repeat_6	1055	1078	5.68e-7	PROSPERO
low complexity region	1081	1096	N/A	INTRINSIC
Pfam:Collagen	1111	1171	9.7e-12	PFAM
Pfam:Collagen	1168	1230	1.4e-9	PFAM
COLFI	1263	1497	1.83e-164	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes the alpha-2 subunit of type V collagen, one of the low abundance fibrillar collagens that gets incorporated into growing fibrils with type I collagen. The encoded protein, in association with alpha-1 and/or alpha-3 subunits, forms homo- or heterotrimeric type V procollagen that undergoes proteolytic processing. Mice lacking the encoded protein die in utero. Transgenic mice that produce a structurally abnormal form of the encoded protein survive poorly and exhibit skin fragility, skeletal abnormalities and alterations in the collagen fiber organization. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutation of this gene results in perinatal lethality. Mutant animals exhibit reduced body weight, reduced bone growth rate, thin, fragile skin, variable degrees of lordosis and kyphosis, abnormal localization of hair follicles in the dermis, and thinned stroma of the cornea. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 25 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd11	A	T	8: 123,616,505 (GRCm39)	I2428N	probably damaging	Het
Ano9	A	G	7: 140,687,195 (GRCm39)	V348A	probably damaging	Het
Cfap69	A	G	5: 5,694,465 (GRCm39)	I132T	probably benign	Het
Chd1l	C	T	3: 97,474,110 (GRCm39)	D791N	probably benign	Het
Chl1	A	G	6: 103,683,583 (GRCm39)	Y819C	probably damaging	Het
Csnk1g1	C	T	9: 65,917,775 (GRCm39)	R45W	probably damaging	Het
Cul7	T	A	17: 46,974,116 (GRCm39)	L1467H	probably damaging	Het
Dgat2l6	G	A	X: 99,586,287 (GRCm39)	V180M	probably damaging	Het
Fscb	G	A	12: 64,518,775 (GRCm39)	P897L	unknown	Het
Herc6	T	C	6: 57,558,092 (GRCm39)	L24P	probably damaging	Het
Il23r	T	A	6: 67,443,269 (GRCm39)	Q278L	probably damaging	Het
Kpna4	A	T	3: 68,991,438 (GRCm39)	V361D	probably damaging	Het
Muc1	A	G	3: 89,137,527 (GRCm39)	D123G	probably benign	Het
Notch4	A	G	17: 34,794,177 (GRCm39)	Y722C	probably damaging	Het
Ntng1	G	C	3: 109,779,570 (GRCm39)	R336G	probably damaging	Het
Or5ac17	T	C	16: 59,036,062 (GRCm39)	M305V	probably benign	Het
Pgbd5	C	T	8: 125,100,994 (GRCm39)	V421M	probably benign	Het
Prkdc	A	G	16: 15,603,835 (GRCm39)	T2950A	possibly damaging	Het
Proser3	A	T	7: 30,238,955 (GRCm39)	D630E	probably benign	Het
Rims4	C	T	2: 163,705,849 (GRCm39)	V262M	possibly damaging	Het
Serpina3g	A	G	12: 104,207,512 (GRCm39)	E225G	probably damaging	Het
Slc2a13	T	C	15: 91,205,870 (GRCm39)	D439G	probably benign	Het
Srebf2	T	C	15: 82,061,610 (GRCm39)	L352P	probably damaging	Het
Trpc5	A	G	X: 143,194,735 (GRCm39)	V590A	probably damaging	Het
Ubqln2	A	T	X: 152,282,665 (GRCm39)	M406L	possibly damaging	Het

Other mutations in Col5a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00567:Col5a2	APN	1	45,432,037 (GRCm39)	splice site	probably benign
IGL00978:Col5a2	APN	1	45,415,899 (GRCm39)	missense	probably benign	0.01
IGL01366:Col5a2	APN	1	45,431,048 (GRCm39)	missense	possibly damaging	0.46
IGL01487:Col5a2	APN	1	45,415,899 (GRCm39)	missense	probably benign	0.01
IGL01820:Col5a2	APN	1	45,481,985 (GRCm39)	missense	unknown
IGL01980:Col5a2	APN	1	45,421,393 (GRCm39)	splice site	probably benign
IGL02063:Col5a2	APN	1	45,442,579 (GRCm39)	critical splice donor site	probably null
IGL02134:Col5a2	APN	1	45,430,230 (GRCm39)	splice site	probably null
IGL02233:Col5a2	APN	1	45,422,747 (GRCm39)	splice site	probably null
IGL02489:Col5a2	APN	1	45,431,971 (GRCm39)	splice site	probably null
IGL02928:Col5a2	APN	1	45,424,180 (GRCm39)	missense	probably benign	0.41
IGL02931:Col5a2	APN	1	45,424,225 (GRCm39)	missense	probably damaging	1.00
IGL03328:Col5a2	APN	1	45,415,306 (GRCm39)	missense	possibly damaging	0.94
Beatnik	UTSW	1	45,415,938 (GRCm39)	missense	probably damaging	0.99
R0022:Col5a2	UTSW	1	45,422,843 (GRCm39)	nonsense	probably null
R0123:Col5a2	UTSW	1	45,446,195 (GRCm39)	missense	probably benign	0.28
R0180:Col5a2	UTSW	1	45,450,620 (GRCm39)	missense	probably damaging	1.00
R0225:Col5a2	UTSW	1	45,446,195 (GRCm39)	missense	probably benign	0.28
R0455:Col5a2	UTSW	1	45,421,262 (GRCm39)	splice site	probably benign
R0485:Col5a2	UTSW	1	45,417,642 (GRCm39)	missense	probably damaging	0.99
R0745:Col5a2	UTSW	1	45,446,387 (GRCm39)	splice site	probably null
R1147:Col5a2	UTSW	1	45,415,931 (GRCm39)	missense	probably damaging	0.99
R1147:Col5a2	UTSW	1	45,415,931 (GRCm39)	missense	probably damaging	0.99
R1394:Col5a2	UTSW	1	45,442,579 (GRCm39)	critical splice donor site	probably null
R1494:Col5a2	UTSW	1	45,542,074 (GRCm39)	start codon destroyed	unknown
R1499:Col5a2	UTSW	1	45,450,626 (GRCm39)	missense	probably benign	0.00
R1733:Col5a2	UTSW	1	45,446,192 (GRCm39)	missense	possibly damaging	0.81
R1789:Col5a2	UTSW	1	45,433,936 (GRCm39)	missense	probably damaging	0.98
R1789:Col5a2	UTSW	1	45,417,465 (GRCm39)	critical splice donor site	probably null
R2114:Col5a2	UTSW	1	45,415,964 (GRCm39)	missense	probably damaging	0.98
R2915:Col5a2	UTSW	1	45,452,656 (GRCm39)	missense	probably damaging	1.00
R3861:Col5a2	UTSW	1	45,419,397 (GRCm39)	missense	probably damaging	0.98
R4015:Col5a2	UTSW	1	45,442,631 (GRCm39)	missense	probably benign	0.14
R4944:Col5a2	UTSW	1	45,415,855 (GRCm39)	missense	possibly damaging	0.75
R4982:Col5a2	UTSW	1	45,428,618 (GRCm39)	missense	possibly damaging	0.88
R5001:Col5a2	UTSW	1	45,542,058 (GRCm39)	missense	unknown
R5159:Col5a2	UTSW	1	45,425,991 (GRCm39)	critical splice donor site	probably null
R5197:Col5a2	UTSW	1	45,432,241 (GRCm39)	missense	probably benign	0.01
R5407:Col5a2	UTSW	1	45,445,440 (GRCm39)	missense	possibly damaging	0.54
R5502:Col5a2	UTSW	1	45,419,286 (GRCm39)	missense	probably damaging	1.00
R5575:Col5a2	UTSW	1	45,417,642 (GRCm39)	missense	probably damaging	0.99
R5622:Col5a2	UTSW	1	45,466,219 (GRCm39)	missense	probably benign
R5643:Col5a2	UTSW	1	45,429,202 (GRCm39)	missense	probably damaging	1.00
R5801:Col5a2	UTSW	1	45,428,641 (GRCm39)	critical splice acceptor site	probably null
R6075:Col5a2	UTSW	1	45,542,008 (GRCm39)	missense	unknown
R6211:Col5a2	UTSW	1	45,415,826 (GRCm39)	missense	probably damaging	0.99
R6407:Col5a2	UTSW	1	45,415,938 (GRCm39)	missense	probably damaging	0.99
R6494:Col5a2	UTSW	1	45,417,487 (GRCm39)	missense	probably damaging	0.99
R6582:Col5a2	UTSW	1	45,429,275 (GRCm39)	missense	possibly damaging	0.91
R6687:Col5a2	UTSW	1	45,422,764 (GRCm39)	missense	probably damaging	1.00
R7007:Col5a2	UTSW	1	45,417,609 (GRCm39)	missense	possibly damaging	0.53
R7062:Col5a2	UTSW	1	45,456,785 (GRCm39)	missense	probably benign	0.00
R7098:Col5a2	UTSW	1	45,419,227 (GRCm39)	missense	possibly damaging	0.48
R7243:Col5a2	UTSW	1	45,415,320 (GRCm39)	missense	probably benign	0.39
R7326:Col5a2	UTSW	1	45,482,027 (GRCm39)	missense	unknown
R7332:Col5a2	UTSW	1	45,419,325 (GRCm39)	missense	probably damaging	1.00
R7642:Col5a2	UTSW	1	45,415,248 (GRCm39)	missense	probably benign	0.01
R7890:Col5a2	UTSW	1	45,444,147 (GRCm39)	splice site	probably null
R8066:Col5a2	UTSW	1	45,452,628 (GRCm39)	critical splice donor site	probably null
R8375:Col5a2	UTSW	1	45,481,890 (GRCm39)	missense	unknown
R8444:Col5a2	UTSW	1	45,435,305 (GRCm39)	missense	probably benign	0.06
R8506:Col5a2	UTSW	1	45,481,944 (GRCm39)	missense	unknown
R8686:Col5a2	UTSW	1	45,461,147 (GRCm39)	missense	probably damaging	1.00
R8907:Col5a2	UTSW	1	45,456,106 (GRCm39)	missense	probably benign	0.27
R8932:Col5a2	UTSW	1	45,419,306 (GRCm39)	missense	probably benign	0.00
R8933:Col5a2	UTSW	1	45,461,123 (GRCm39)	missense
R9087:Col5a2	UTSW	1	45,481,818 (GRCm39)	missense	unknown
R9105:Col5a2	UTSW	1	45,419,366 (GRCm39)	missense	probably benign	0.00
R9282:Col5a2	UTSW	1	45,478,029 (GRCm39)	critical splice donor site	probably null
R9457:Col5a2	UTSW	1	45,431,973 (GRCm39)	critical splice donor site	probably null
R9457:Col5a2	UTSW	1	45,426,004 (GRCm39)	missense	probably benign	0.00
R9568:Col5a2	UTSW	1	45,430,998 (GRCm39)	missense	possibly damaging	0.89
R9727:Col5a2	UTSW	1	45,415,818 (GRCm39)	missense	possibly damaging	0.50
X0013:Col5a2	UTSW	1	45,442,418 (GRCm39)	critical splice donor site	probably null
Z1176:Col5a2	UTSW	1	45,435,644 (GRCm39)	missense	probably benign	0.11
Z1176:Col5a2	UTSW	1	45,422,840 (GRCm39)	missense	probably damaging	1.00
Z1176:Col5a2	UTSW	1	45,415,306 (GRCm39)	missense	possibly damaging	0.94
Z1177:Col5a2	UTSW	1	45,442,633 (GRCm39)	missense	probably damaging	1.00
Z1177:Col5a2	UTSW	1	45,441,273 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTTTTACTCAAACAGGCCCCTGTC -3'
(R):5'- TGCCAAGTTGTAAATGTCCCCACAC -3'

Sequencing Primer
(F):5'- AACAGGCCCCTGTCTACTC -3'
(R):5'- ACACAGCATAGTAAGCAATTTCG -3'

Posted On

2013-07-30