Incidental Mutation 'R8099:Ppm1d'
ID 630414
Institutional Source Beutler Lab
Gene Symbol Ppm1d
Ensembl Gene ENSMUSG00000020525
Gene Name protein phosphatase 1D magnesium-dependent, delta isoform
Synonyms Wip1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8099 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 85311244-85347066 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 85339666 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 370 (P370L)
Ref Sequence ENSEMBL: ENSMUSP00000020835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020835] [ENSMUST00000127717]
AlphaFold Q9QZ67
Predicted Effect possibly damaging
Transcript: ENSMUST00000020835
AA Change: P370L

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000020835
Gene: ENSMUSG00000020525
AA Change: P370L

DomainStartEndE-ValueType
PP2Cc 1 366 1.4e-76 SMART
PP2C_SIG 78 368 6.09e0 SMART
low complexity region 403 415 N/A INTRINSIC
Blast:PP2Cc 416 476 1e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000127717
SMART Domains Protein: ENSMUSP00000115606
Gene: ENSMUSG00000020525

DomainStartEndE-ValueType
PP2Cc 1 170 2.87e-5 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.1%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the PP2C family of Ser/Thr protein phosphatases. PP2C family members are known to be negative regulators of cell stress response pathways. The expression of this gene is induced in a p53-dependent manner in response to various environmental stresses. While being induced by tumor suppressor protein TP53/p53, this phosphatase negatively regulates the activity of p38 MAP kinase, MAPK/p38, through which it reduces the phosphorylation of p53, and in turn suppresses p53-mediated transcription and apoptosis. This phosphatase thus mediates a feedback regulation of p38-p53 signaling that contributes to growth inhibition and the suppression of stress induced apoptosis. This gene is located in a chromosomal region known to be amplified in breast cancer. The amplification of this gene has been detected in both breast cancer cell line and primary breast tumors, which suggests a role of this gene in cancer development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null male mice show some embryonic lethality. Surviving males have variable abnormalities including runting, reproductive organ atrophy with associated reduced fertility, and reduced life span. Both genders have increased susceptibility to viral infection and reduced lymphocyte function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik T C 14: 70,157,520 R62G probably benign Het
Abcb9 A G 5: 124,077,245 F478L probably benign Het
Abcc9 A T 6: 142,675,531 N494K probably damaging Het
Atp11a T G 8: 12,861,973 M124R Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Ccdc110 T A 8: 45,942,093 H340Q probably damaging Het
Celsr1 A G 15: 86,031,600 L724P probably damaging Het
Cfap74 A G 4: 155,455,032 N938S unknown Het
Chil3 T G 3: 106,148,668 D363A probably damaging Het
Ciart G A 3: 95,881,344 P61L probably damaging Het
Cpne3 A G 4: 19,525,169 V442A possibly damaging Het
Ctsh T C 9: 90,064,247 V130A probably damaging Het
Cyp3a44 T C 5: 145,788,402 K330E probably benign Het
Dgcr2 A T 16: 17,849,769 D275E probably damaging Het
Dnah1 A T 14: 31,302,364 D919E probably benign Het
Ell3 TCTCCTC TCTC 2: 121,439,456 probably benign Het
Epb41l3 T A 17: 69,247,688 F261Y possibly damaging Het
Fam189b T C 3: 89,183,943 F74L probably damaging Het
Fbxo3 A C 2: 104,054,935 H383P probably damaging Het
Foxp1 C T 6: 98,945,549 V441M unknown Het
Gm29106 C T 1: 118,198,791 S71F probably benign Het
Golga3 T A 5: 110,188,707 L364* probably null Het
Herc1 T A 9: 66,372,140 L110H probably damaging Het
Hist1h1a C T 13: 23,763,849 L45F probably damaging Het
Igkv4-53 A T 6: 69,648,914 S90T possibly damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Kti12 G T 4: 108,848,374 G162W probably damaging Het
Lama3 T A 18: 12,534,063 I763N probably damaging Het
Macf1 A T 4: 123,476,129 I1613K probably benign Het
Mkrn1 T C 6: 39,410,097 D102G probably benign Het
Muc2 T A 7: 141,745,438 probably null Het
Nipal4 T C 11: 46,162,021 E39G probably benign Het
Nr1h2 T C 7: 44,550,322 Y391C possibly damaging Het
Odam T C 5: 87,892,440 I255T possibly damaging Het
Olfr1154 T A 2: 87,903,508 H56L probably damaging Het
Olfr279 A G 15: 98,497,813 M114V probably benign Het
Olfr781 T A 10: 129,333,127 I82K probably damaging Het
Per3 A T 4: 151,012,557 M837K possibly damaging Het
Pitpnm3 T A 11: 72,070,318 H357L possibly damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Plcb1 T C 2: 135,251,734 Y156H possibly damaging Het
Prrc2b T C 2: 32,208,674 V666A probably benign Het
Ptpn3 A T 4: 57,204,985 C725* probably null Het
Rapgefl1 T C 11: 98,847,383 W437R probably damaging Het
Sema4g T C 19: 44,992,528 L5P probably damaging Het
Sipa1l1 C T 12: 82,433,826 P1529L probably benign Het
Slc12a2 T C 18: 57,899,392 L388P probably damaging Het
Sltm T A 9: 70,586,078 S786T probably damaging Het
Srsf1 T C 11: 88,049,256 I198T probably benign Het
Ssh2 C T 11: 77,454,929 R1247* probably null Het
Ssu2 T C 6: 112,376,477 T229A probably benign Het
Stra6 T A 9: 58,152,494 H579Q probably damaging Het
Tanc2 T A 11: 105,864,007 V559E probably benign Het
Trp53bp1 A G 2: 121,199,749 Y1762H probably damaging Het
Usp15 T C 10: 123,146,921 Y263C possibly damaging Het
Usp17ld A T 7: 103,250,288 V479E probably damaging Het
Vmn2r15 A T 5: 109,293,319 S224R possibly damaging Het
Vmn2r8 A T 5: 108,801,834 N382K probably benign Het
Vmn2r94 T C 17: 18,257,397 I251V probably benign Het
Wnt2b A T 3: 104,947,092 V350D possibly damaging Het
Other mutations in Ppm1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02095:Ppm1d APN 11 85327006 missense probably benign 0.04
IGL02351:Ppm1d APN 11 85345715 missense probably damaging 0.99
IGL02358:Ppm1d APN 11 85345715 missense probably damaging 0.99
IGL02496:Ppm1d APN 11 85339666 missense possibly damaging 0.51
IGL02667:Ppm1d APN 11 85332285 missense probably damaging 1.00
IGL02885:Ppm1d APN 11 85326944 missense possibly damaging 0.52
IGL03085:Ppm1d APN 11 85337163 missense probably null 0.80
R0114:Ppm1d UTSW 11 85326905 missense probably damaging 1.00
R0606:Ppm1d UTSW 11 85345877 missense probably benign 0.27
R1014:Ppm1d UTSW 11 85337154 missense probably damaging 0.98
R1548:Ppm1d UTSW 11 85339605 missense probably damaging 1.00
R3774:Ppm1d UTSW 11 85337167 missense probably damaging 1.00
R3775:Ppm1d UTSW 11 85337167 missense probably damaging 1.00
R4025:Ppm1d UTSW 11 85345757 missense probably benign 0.09
R4065:Ppm1d UTSW 11 85345852 missense probably benign 0.01
R4067:Ppm1d UTSW 11 85345852 missense probably benign 0.01
R4118:Ppm1d UTSW 11 85311582 missense probably benign 0.01
R5169:Ppm1d UTSW 11 85332370 missense probably damaging 1.00
R5384:Ppm1d UTSW 11 85311783 missense probably damaging 0.98
R5861:Ppm1d UTSW 11 85311848 missense possibly damaging 0.70
R5890:Ppm1d UTSW 11 85326908 missense probably damaging 1.00
R6394:Ppm1d UTSW 11 85339672 missense probably benign
R6992:Ppm1d UTSW 11 85332352 missense probably damaging 1.00
R7006:Ppm1d UTSW 11 85337151 missense possibly damaging 0.92
R7297:Ppm1d UTSW 11 85345995 missense probably damaging 1.00
R7993:Ppm1d UTSW 11 85326951 missense probably damaging 1.00
R8697:Ppm1d UTSW 11 85337160 missense possibly damaging 0.95
R8738:Ppm1d UTSW 11 85345906 missense probably damaging 0.99
R9018:Ppm1d UTSW 11 85337135 missense probably damaging 0.98
R9188:Ppm1d UTSW 11 85345921 missense possibly damaging 0.93
Z1176:Ppm1d UTSW 11 85339573 missense probably benign 0.09
Z1177:Ppm1d UTSW 11 85326963 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGAGGAGCTGGTGACTCCTAT -3'
(R):5'- CTCTGAAACCACAAGCCAGATT -3'

Sequencing Primer
(F):5'- AGCTGGTGACTCCTATCATGTAAGTC -3'
(R):5'- GTCATGGTGCTTTATCAGGAATAG -3'
Posted On 2020-06-30