Incidental Mutation 'R0702:Muc1'
ID63043
Institutional Source Beutler Lab
Gene Symbol Muc1
Ensembl Gene ENSMUSG00000042784
Gene Namemucin 1, transmembrane
SynonymsEMA, CD227, Muc-1
MMRRC Submission 038885-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.399) question?
Stock #R0702 (G1)
Quality Score139
Status Not validated
Chromosome3
Chromosomal Location89229057-89233381 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89230220 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 123 (D123G)
Ref Sequence ENSEMBL: ENSMUSP00000041963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029682] [ENSMUST00000041022] [ENSMUST00000041142] [ENSMUST00000090924] [ENSMUST00000107464] [ENSMUST00000119084] [ENSMUST00000143637] [ENSMUST00000174126]
Predicted Effect probably benign
Transcript: ENSMUST00000029682
SMART Domains Protein: ENSMUSP00000029682
Gene: ENSMUSG00000028047

DomainStartEndE-ValueType
TSPN 21 193 4.71e-56 SMART
Pfam:COMP 226 270 2.5e-22 PFAM
EGF 277 315 8.19e-2 SMART
EGF_CA 316 369 6.91e-9 SMART
EGF_CA 370 413 1.38e-8 SMART
EGF 417 456 1.99e0 SMART
Pfam:TSP_3 492 527 1e-12 PFAM
Pfam:TSP_3 551 586 2.2e-16 PFAM
Pfam:TSP_3 586 609 6.6e-7 PFAM
Pfam:TSP_3 610 647 2.6e-14 PFAM
Pfam:TSP_3 648 687 2.4e-10 PFAM
Pfam:TSP_3 688 723 4.2e-15 PFAM
Pfam:TSP_C 741 938 3.3e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000041022
SMART Domains Protein: ENSMUSP00000036053
Gene: ENSMUSG00000042766

DomainStartEndE-ValueType
RING 33 133 1.92e-6 SMART
BBOX 222 263 9.59e-7 SMART
Blast:BBC 271 395 3e-13 BLAST
FN3 430 515 2.03e-2 SMART
low complexity region 561 571 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000041142
AA Change: D123G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000041963
Gene: ENSMUSG00000042784
AA Change: D123G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 30 46 N/A INTRINSIC
internal_repeat_2 48 106 4.93e-6 PROSPERO
internal_repeat_1 79 151 3.46e-38 PROSPERO
low complexity region 153 181 N/A INTRINSIC
internal_repeat_1 183 254 3.46e-38 PROSPERO
internal_repeat_2 192 259 4.93e-6 PROSPERO
low complexity region 277 292 N/A INTRINSIC
low complexity region 296 307 N/A INTRINSIC
low complexity region 370 381 N/A INTRINSIC
low complexity region 382 400 N/A INTRINSIC
SEA 412 528 6.2e-43 SMART
low complexity region 537 552 N/A INTRINSIC
Blast:SEA 557 624 2e-36 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000090924
SMART Domains Protein: ENSMUSP00000088442
Gene: ENSMUSG00000042766

DomainStartEndE-ValueType
RING 20 120 1.92e-6 SMART
BBOX 209 250 9.59e-7 SMART
Blast:BBC 258 382 8e-13 BLAST
FN3 417 502 2.03e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102300
Predicted Effect probably benign
Transcript: ENSMUST00000107464
SMART Domains Protein: ENSMUSP00000103088
Gene: ENSMUSG00000042766

DomainStartEndE-ValueType
RING 10 110 1.92e-6 SMART
BBOX 199 240 9.59e-7 SMART
Blast:BBC 248 372 2e-13 BLAST
FN3 407 492 2.03e-2 SMART
low complexity region 538 548 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119084
SMART Domains Protein: ENSMUSP00000112912
Gene: ENSMUSG00000028047

DomainStartEndE-ValueType
TSPN 21 193 4.71e-56 SMART
Pfam:COMP 226 270 8.2e-26 PFAM
EGF 277 315 8.19e-2 SMART
EGF_CA 316 369 6.91e-9 SMART
EGF_CA 370 413 1.38e-8 SMART
Pfam:TSP_3 455 490 4.4e-13 PFAM
Pfam:TSP_3 514 549 9.3e-17 PFAM
Pfam:TSP_3 549 572 2.8e-7 PFAM
Pfam:TSP_3 573 610 1.1e-14 PFAM
Pfam:TSP_3 611 650 1e-10 PFAM
Pfam:TSP_3 651 686 1.8e-15 PFAM
Pfam:TSP_C 704 904 7.9e-108 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126315
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126372
Predicted Effect probably benign
Transcript: ENSMUST00000136881
SMART Domains Protein: ENSMUSP00000120337
Gene: ENSMUSG00000028047

DomainStartEndE-ValueType
Pfam:TSP_3 1 31 5.8e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139419
Predicted Effect probably benign
Transcript: ENSMUST00000143637
SMART Domains Protein: ENSMUSP00000119270
Gene: ENSMUSG00000042766

DomainStartEndE-ValueType
RING 33 133 1.92e-6 SMART
BBOX 222 263 9.59e-7 SMART
Blast:BBC 270 391 4e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144980
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146844
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155924
Predicted Effect probably benign
Transcript: ENSMUST00000174126
SMART Domains Protein: ENSMUSP00000133291
Gene: ENSMUSG00000064068

DomainStartEndE-ValueType
Pfam:Tom37_C 1 74 7.6e-23 PFAM
Pfam:GST_C_3 7 143 7.3e-12 PFAM
Pfam:GST_C_2 26 137 2.8e-9 PFAM
Pfam:Tom37_C 61 129 6.2e-15 PFAM
low complexity region 159 169 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174324
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display delayed mammary tumor progression, impaired intestinal absorption of cholesterol, decreased gastric mucus accumulation, reduced secretion and accumulation of gallbladder mucin, and decreased susceptibility to cholesterol gallstone formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd11 A T 8: 122,889,766 I2428N probably damaging Het
Ano9 A G 7: 141,107,282 V348A probably damaging Het
Cfap69 A G 5: 5,644,465 I132T probably benign Het
Chd1l C T 3: 97,566,794 D791N probably benign Het
Chl1 A G 6: 103,706,622 Y819C probably damaging Het
Col5a2 T A 1: 45,380,131 D1263V possibly damaging Het
Csnk1g1 C T 9: 66,010,493 R45W probably damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Dgat2l6 G A X: 100,542,681 V180M probably damaging Het
Fscb G A 12: 64,472,001 P897L unknown Het
Herc6 T C 6: 57,581,107 L24P probably damaging Het
Il23r T A 6: 67,466,285 Q278L probably damaging Het
Kpna4 A T 3: 69,084,105 V361D probably damaging Het
Notch4 A G 17: 34,575,203 Y722C probably damaging Het
Ntng1 G C 3: 109,872,254 R336G probably damaging Het
Olfr199 T C 16: 59,215,699 M305V probably benign Het
Pgbd5 C T 8: 124,374,255 V421M probably benign Het
Prkdc A G 16: 15,785,971 T2950A possibly damaging Het
Proser3 A T 7: 30,539,530 D630E probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Serpina3g A G 12: 104,241,253 E225G probably damaging Het
Slc2a13 T C 15: 91,321,667 D439G probably benign Het
Srebf2 T C 15: 82,177,409 L352P probably damaging Het
Trpc5 A G X: 144,411,739 V590A probably damaging Het
Ubqln2 A T X: 153,499,669 M406L possibly damaging Het
Other mutations in Muc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Muc1 APN 3 89230754 missense probably benign 0.01
IGL01549:Muc1 APN 3 89231810 missense probably damaging 1.00
IGL01969:Muc1 APN 3 89232006 missense probably damaging 1.00
IGL02233:Muc1 APN 3 89231628 missense probably benign 0.11
IGL03160:Muc1 APN 3 89233024 missense possibly damaging 0.89
R0670:Muc1 UTSW 3 89230532 missense probably benign 0.00
R0682:Muc1 UTSW 3 89231132 missense probably damaging 1.00
R0744:Muc1 UTSW 3 89230328 missense possibly damaging 0.92
R1137:Muc1 UTSW 3 89230438 missense probably benign 0.00
R1270:Muc1 UTSW 3 89232107 missense probably damaging 1.00
R1673:Muc1 UTSW 3 89231772 missense possibly damaging 0.76
R1869:Muc1 UTSW 3 89231810 missense probably damaging 1.00
R2169:Muc1 UTSW 3 89231596 missense probably damaging 1.00
R4460:Muc1 UTSW 3 89231563 missense probably damaging 0.98
R4461:Muc1 UTSW 3 89231563 missense probably damaging 0.98
R4672:Muc1 UTSW 3 89232077 missense probably damaging 0.99
R5892:Muc1 UTSW 3 89230993 missense probably benign 0.04
R6039:Muc1 UTSW 3 89232029 missense probably damaging 1.00
R6039:Muc1 UTSW 3 89232029 missense probably damaging 1.00
R6931:Muc1 UTSW 3 89229159 unclassified probably benign
R7400:Muc1 UTSW 3 89230646 missense possibly damaging 0.63
X0065:Muc1 UTSW 3 89230286 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CAGCAGTTCCTTAGCATCGACTACC -3'
(R):5'- GCGGAGTCTTCTGAAAGGCTAGTG -3'

Sequencing Primer
(F):5'- TTAGCATCGACTACCACTCCAG -3'
(R):5'- TCATCATGGGCTACTGGAGAG -3'
Posted On2013-07-30