Incidental Mutation 'R8100:Olfr1256'
ID630435
Institutional Source Beutler Lab
Gene Symbol Olfr1256
Ensembl Gene ENSMUSG00000075073
Gene Nameolfactory receptor 1256
SynonymsGA_x6K02T2Q125-51276848-51275928, MOR231-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R8100 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location89825311-89841555 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 89835685 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 87 (Q87*)
Ref Sequence ENSEMBL: ENSMUSP00000150906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099763] [ENSMUST00000111520] [ENSMUST00000213833] [ENSMUST00000215613]
Predicted Effect probably null
Transcript: ENSMUST00000099763
AA Change: Q87*
SMART Domains Protein: ENSMUSP00000097351
Gene: ENSMUSG00000075073
AA Change: Q87*

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 33 300 1.1e-5 PFAM
Pfam:7tm_1 39 285 5.3e-28 PFAM
Pfam:7tm_4 137 278 7.1e-39 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000111520
AA Change: Q87*
SMART Domains Protein: ENSMUSP00000107145
Gene: ENSMUSG00000075073
AA Change: Q87*

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.5e-47 PFAM
Pfam:7TM_GPCR_Srsx 33 300 1.1e-5 PFAM
Pfam:7tm_1 39 285 1.3e-16 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000213833
AA Change: Q87*
Predicted Effect probably null
Transcript: ENSMUST00000215613
AA Change: Q87*
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 G A 14: 55,772,265 Q777* probably null Het
Art1 T C 7: 102,107,198 S199P probably damaging Het
Cadps2 A T 6: 23,838,809 M110K probably damaging Het
Cdk13 C T 13: 17,803,516 R379Q unknown Het
Cdk7 T C 13: 100,706,417 I272V probably benign Het
Cep350 T C 1: 155,953,402 D192G probably damaging Het
Chrna6 C T 8: 27,413,816 probably benign Het
Ciart G A 3: 95,881,344 P61L probably damaging Het
Ckmt1 T A 2: 121,360,777 D223E probably benign Het
Col6a5 C T 9: 105,878,640 R2195H probably damaging Het
D430041D05Rik C T 2: 104,256,942 R563H probably benign Het
Defa29 A T 8: 21,326,974 M1K probably null Het
Dnah11 A G 12: 117,966,633 S3326P probably damaging Het
Dsg3 A G 18: 20,528,971 D431G probably benign Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Ell3 TCTCCTC TCTC 2: 121,439,456 probably benign Het
Fbln1 T A 15: 85,285,156 F699I probably damaging Het
Fndc1 A G 17: 7,771,853 S1004P unknown Het
Gpr15 T A 16: 58,717,713 T338S probably benign Het
Grin2d T C 7: 45,833,747 Y1002C unknown Het
Hk2 C T 6: 82,730,878 M703I probably benign Het
Ifi213 A C 1: 173,595,182 L39R probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Lama2 C A 10: 27,041,117 A2271S probably benign Het
Lmo7 A T 14: 101,900,463 Q867L probably benign Het
Loxhd1 T A 18: 77,404,816 S1427T possibly damaging Het
Lzts1 A G 8: 69,140,745 V70A probably damaging Het
Mocs3 A G 2: 168,231,337 T235A possibly damaging Het
Myo15 G A 11: 60,517,190 R3168H probably damaging Het
Ndc1 A G 4: 107,383,605 D260G possibly damaging Het
Nfam1 T C 15: 83,016,529 D44G probably damaging Het
Osbpl10 G A 9: 115,167,254 R128H probably benign Het
Otx1 C A 11: 21,999,392 V29L probably benign Het
Pogk A T 1: 166,401,942 D113E possibly damaging Het
Ptgs2 T C 1: 150,102,721 F195L probably damaging Het
Ptpn21 T A 12: 98,682,622 E925V possibly damaging Het
Ranbp2 T C 10: 58,490,648 F2714L possibly damaging Het
Rbm20 T G 19: 53,851,313 I911S possibly damaging Het
Rwdd2b A G 16: 87,436,621 V197A possibly damaging Het
Sel1l2 C G 2: 140,275,409 A181P probably damaging Het
Sf1 A G 19: 6,372,338 E234G possibly damaging Het
Skint2 A C 4: 112,626,000 T201P probably damaging Het
Sra1 C T 18: 36,676,895 R199H probably damaging Het
Svs2 A G 2: 164,237,792 M65T probably benign Het
Tgif1 C A 17: 70,846,549 probably benign Het
Tmem184c A G 8: 77,604,782 W113R possibly damaging Het
Tmem30a T C 9: 79,774,150 R282G probably benign Het
Top1 T A 2: 160,698,235 Y244* probably null Het
Trank1 A G 9: 111,392,793 Y2866C probably damaging Het
Trim7 A C 11: 48,849,519 I148L probably damaging Het
Triml1 T A 8: 43,138,680 M214L probably benign Het
Usp30 T G 5: 114,111,184 V183G probably damaging Het
Vmn1r175 G A 7: 23,808,587 S205F probably damaging Het
Zbtb32 CTTG CTTGTTG 7: 30,591,521 probably benign Het
Zfp108 T A 7: 24,261,177 C398S probably damaging Het
Zfp592 T G 7: 81,024,192 D301E probably benign Het
Other mutations in Olfr1256
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Olfr1256 APN 2 89835458 nonsense probably null
IGL01082:Olfr1256 APN 2 89844063 unclassified probably benign
IGL01613:Olfr1256 APN 2 89835808 missense probably damaging 0.98
IGL01969:Olfr1256 APN 2 89835720 missense probably benign 0.01
IGL02625:Olfr1256 APN 2 89835396 missense probably damaging 1.00
R0843:Olfr1256 UTSW 2 89835616 missense probably benign 0.01
R1270:Olfr1256 UTSW 2 89835322 missense possibly damaging 0.90
R1521:Olfr1256 UTSW 2 89835172 nonsense probably null
R2219:Olfr1256 UTSW 2 89835425 missense probably damaging 1.00
R2881:Olfr1256 UTSW 2 89844984 splice site probably null
R3121:Olfr1256 UTSW 2 89835514 missense probably benign
R3609:Olfr1256 UTSW 2 89835076 missense probably damaging 0.99
R4984:Olfr1256 UTSW 2 89835813 missense probably damaging 1.00
R5153:Olfr1256 UTSW 2 89835234 missense possibly damaging 0.77
R5640:Olfr1256 UTSW 2 89835938 missense probably benign 0.08
R7198:Olfr1256 UTSW 2 89835732 missense probably damaging 1.00
R7862:Olfr1256 UTSW 2 89835124 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- ACTGAGCTGAATTACTGAGTGC -3'
(R):5'- TTGGGCCTCTCAGAGAATCC -3'

Sequencing Primer
(F):5'- TTACTGAGTGCAAAAATCCTCCG -3'
(R):5'- TCCAAAGGTGCAGAAAGGACTTTTC -3'
Posted On2020-06-30