Incidental Mutation 'R8100:Svs2'
ID630441
Institutional Source Beutler Lab
Gene Symbol Svs2
Ensembl Gene ENSMUSG00000040132
Gene Nameseminal vesicle secretory protein 2
Synonymssemenoclotin, SVS II
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8100 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location164235929-164238466 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 164237792 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 65 (M65T)
Ref Sequence ENSEMBL: ENSMUSP00000042389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044953] [ENSMUST00000109374]
Predicted Effect probably benign
Transcript: ENSMUST00000044953
AA Change: M65T

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000042389
Gene: ENSMUSG00000040132
AA Change: M65T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:SVS_QK 110 121 1.2e-6 PFAM
Pfam:SVS_QK 122 137 3.9e-3 PFAM
Pfam:SVS_QK 139 149 1.3e-5 PFAM
Pfam:SVS_QK 151 166 8.4e-4 PFAM
Pfam:SVS_QK 168 179 5.3e-6 PFAM
Pfam:SVS_QK 180 195 3.9e-3 PFAM
Pfam:SVS_QK 197 207 1.3e-5 PFAM
Pfam:SVS_QK 210 221 8.8e-5 PFAM
Pfam:SVS_QK 225 236 7.7e-6 PFAM
Pfam:SVS_QK 238 249 6.1e-6 PFAM
Pfam:SVS_QK 249 260 5.2e-4 PFAM
Pfam:SVS_QK 262 272 3.1e-5 PFAM
Pfam:SVS_QK 323 334 6.7e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109374
AA Change: M65T

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000104999
Gene: ENSMUSG00000040132
AA Change: M65T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:SVS_QK 110 121 1.2e-6 PFAM
Pfam:SVS_QK 122 137 3.9e-3 PFAM
Pfam:SVS_QK 139 149 1.3e-5 PFAM
Pfam:SVS_QK 151 166 8.4e-4 PFAM
Pfam:SVS_QK 168 179 5.3e-6 PFAM
Pfam:SVS_QK 180 195 3.9e-3 PFAM
Pfam:SVS_QK 197 207 1.3e-5 PFAM
Pfam:SVS_QK 210 221 8.8e-5 PFAM
Pfam:SVS_QK 225 236 7.7e-6 PFAM
Pfam:SVS_QK 238 249 6.1e-6 PFAM
Pfam:SVS_QK 249 260 5.2e-4 PFAM
Pfam:SVS_QK 262 272 3.1e-5 PFAM
Pfam:SVS_QK 323 334 6.7e-5 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male mice homozygous for a null allele display severely reduced fertility with premature acrosome reaction, absence of copulatory plug formation and intrauterine death of sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 G A 14: 55,772,265 Q777* probably null Het
Art1 T C 7: 102,107,198 S199P probably damaging Het
Cadps2 A T 6: 23,838,809 M110K probably damaging Het
Cdk13 C T 13: 17,803,516 R379Q unknown Het
Cdk7 T C 13: 100,706,417 I272V probably benign Het
Cep350 T C 1: 155,953,402 D192G probably damaging Het
Chrna6 C T 8: 27,413,816 probably benign Het
Ciart G A 3: 95,881,344 P61L probably damaging Het
Ckmt1 T A 2: 121,360,777 D223E probably benign Het
Col6a5 C T 9: 105,878,640 R2195H probably damaging Het
D430041D05Rik C T 2: 104,256,942 R563H probably benign Het
Defa29 A T 8: 21,326,974 M1K probably null Het
Dnah11 A G 12: 117,966,633 S3326P probably damaging Het
Dsg3 A G 18: 20,528,971 D431G probably benign Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Ell3 TCTCCTC TCTC 2: 121,439,456 probably benign Het
Fbln1 T A 15: 85,285,156 F699I probably damaging Het
Fndc1 A G 17: 7,771,853 S1004P unknown Het
Gpr15 T A 16: 58,717,713 T338S probably benign Het
Grin2d T C 7: 45,833,747 Y1002C unknown Het
Hk2 C T 6: 82,730,878 M703I probably benign Het
Ifi213 A C 1: 173,595,182 L39R probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Lama2 C A 10: 27,041,117 A2271S probably benign Het
Lmo7 A T 14: 101,900,463 Q867L probably benign Het
Loxhd1 T A 18: 77,404,816 S1427T possibly damaging Het
Lzts1 A G 8: 69,140,745 V70A probably damaging Het
Mocs3 A G 2: 168,231,337 T235A possibly damaging Het
Myo15 G A 11: 60,517,190 R3168H probably damaging Het
Ndc1 A G 4: 107,383,605 D260G possibly damaging Het
Nfam1 T C 15: 83,016,529 D44G probably damaging Het
Olfr1256 G A 2: 89,835,685 Q87* probably null Het
Osbpl10 G A 9: 115,167,254 R128H probably benign Het
Otx1 C A 11: 21,999,392 V29L probably benign Het
Pogk A T 1: 166,401,942 D113E possibly damaging Het
Ptgs2 T C 1: 150,102,721 F195L probably damaging Het
Ptpn21 T A 12: 98,682,622 E925V possibly damaging Het
Ranbp2 T C 10: 58,490,648 F2714L possibly damaging Het
Rbm20 T G 19: 53,851,313 I911S possibly damaging Het
Rwdd2b A G 16: 87,436,621 V197A possibly damaging Het
Sel1l2 C G 2: 140,275,409 A181P probably damaging Het
Sf1 A G 19: 6,372,338 E234G possibly damaging Het
Skint2 A C 4: 112,626,000 T201P probably damaging Het
Sra1 C T 18: 36,676,895 R199H probably damaging Het
Tgif1 C A 17: 70,846,549 probably benign Het
Tmem184c A G 8: 77,604,782 W113R possibly damaging Het
Tmem30a T C 9: 79,774,150 R282G probably benign Het
Top1 T A 2: 160,698,235 Y244* probably null Het
Trank1 A G 9: 111,392,793 Y2866C probably damaging Het
Trim7 A C 11: 48,849,519 I148L probably damaging Het
Triml1 T A 8: 43,138,680 M214L probably benign Het
Usp30 T G 5: 114,111,184 V183G probably damaging Het
Vmn1r175 G A 7: 23,808,587 S205F probably damaging Het
Zbtb32 CTTG CTTGTTG 7: 30,591,521 probably benign Het
Zfp108 T A 7: 24,261,177 C398S probably damaging Het
Zfp592 T G 7: 81,024,192 D301E probably benign Het
Other mutations in Svs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Svs2 APN 2 164237042 missense possibly damaging 0.86
IGL01722:Svs2 APN 2 164237526 missense possibly damaging 0.71
IGL03189:Svs2 APN 2 164237112 missense possibly damaging 0.73
R1276:Svs2 UTSW 2 164237248 missense possibly damaging 0.95
R1541:Svs2 UTSW 2 164237009 missense possibly damaging 0.71
R1590:Svs2 UTSW 2 164237658 missense possibly damaging 0.86
R3946:Svs2 UTSW 2 164237127 missense probably benign 0.01
R3965:Svs2 UTSW 2 164237742 missense possibly damaging 0.53
R4075:Svs2 UTSW 2 164237318 missense probably benign 0.01
R4632:Svs2 UTSW 2 164237747 missense probably benign 0.40
R4732:Svs2 UTSW 2 164237123 missense possibly damaging 0.87
R4733:Svs2 UTSW 2 164237123 missense possibly damaging 0.87
R4839:Svs2 UTSW 2 164236886 missense probably benign 0.40
R5706:Svs2 UTSW 2 164237669 missense possibly damaging 0.53
R6936:Svs2 UTSW 2 164237628 missense possibly damaging 0.86
R7052:Svs2 UTSW 2 164238206 missense unknown
R7836:Svs2 UTSW 2 164237580 missense possibly damaging 0.86
R8035:Svs2 UTSW 2 164237133 missense probably benign 0.18
R8187:Svs2 UTSW 2 164237772 missense possibly damaging 0.88
R8310:Svs2 UTSW 2 164238171 missense probably damaging 1.00
R8312:Svs2 UTSW 2 164238171 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGACACACTGGACTTCAC -3'
(R):5'- TTGGAAGGACTGTGCAGATTAC -3'

Sequencing Primer
(F):5'- AAGGCTGATCCTCCAGATTTCAG -3'
(R):5'- AGGACTGTGCAGATTACGTAAC -3'
Posted On2020-06-30