Incidental Mutation 'R8100:Triml1'
ID630458
Institutional Source Beutler Lab
Gene Symbol Triml1
Ensembl Gene ENSMUSG00000031651
Gene Nametripartite motif family-like 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R8100 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location43129807-43141486 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43138680 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 214 (M214L)
Ref Sequence ENSEMBL: ENSMUSP00000050267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059692]
Predicted Effect probably benign
Transcript: ENSMUST00000059692
AA Change: M214L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000050267
Gene: ENSMUSG00000031651
AA Change: M214L

DomainStartEndE-ValueType
RING 22 62 1.14e-8 SMART
coiled coil region 196 235 N/A INTRINSIC
PRY 291 343 4.64e-23 SMART
Pfam:SPRY 346 462 6.6e-14 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a tripartite motif family protein with similarities to E3 ubiquitin-protein ligases. While the function of the encoded protein has not been determined, the orthologous protein in mouse has been shown to bind ubiquitin-specific protease 5 and is involved in the blastocyst development stage. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 G A 14: 55,772,265 Q777* probably null Het
Art1 T C 7: 102,107,198 S199P probably damaging Het
Cadps2 A T 6: 23,838,809 M110K probably damaging Het
Cdk13 C T 13: 17,803,516 R379Q unknown Het
Cdk7 T C 13: 100,706,417 I272V probably benign Het
Cep350 T C 1: 155,953,402 D192G probably damaging Het
Chrna6 C T 8: 27,413,816 probably benign Het
Ciart G A 3: 95,881,344 P61L probably damaging Het
Ckmt1 T A 2: 121,360,777 D223E probably benign Het
Col6a5 C T 9: 105,878,640 R2195H probably damaging Het
D430041D05Rik C T 2: 104,256,942 R563H probably benign Het
Defa29 A T 8: 21,326,974 M1K probably null Het
Dnah11 A G 12: 117,966,633 S3326P probably damaging Het
Dsg3 A G 18: 20,528,971 D431G probably benign Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Ell3 TCTCCTC TCTC 2: 121,439,456 probably benign Het
Fbln1 T A 15: 85,285,156 F699I probably damaging Het
Fndc1 A G 17: 7,771,853 S1004P unknown Het
Gpr15 T A 16: 58,717,713 T338S probably benign Het
Grin2d T C 7: 45,833,747 Y1002C unknown Het
Hk2 C T 6: 82,730,878 M703I probably benign Het
Ifi213 A C 1: 173,595,182 L39R probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Lama2 C A 10: 27,041,117 A2271S probably benign Het
Lmo7 A T 14: 101,900,463 Q867L probably benign Het
Loxhd1 T A 18: 77,404,816 S1427T possibly damaging Het
Lzts1 A G 8: 69,140,745 V70A probably damaging Het
Mocs3 A G 2: 168,231,337 T235A possibly damaging Het
Myo15 G A 11: 60,517,190 R3168H probably damaging Het
Ndc1 A G 4: 107,383,605 D260G possibly damaging Het
Nfam1 T C 15: 83,016,529 D44G probably damaging Het
Olfr1256 G A 2: 89,835,685 Q87* probably null Het
Osbpl10 G A 9: 115,167,254 R128H probably benign Het
Otx1 C A 11: 21,999,392 V29L probably benign Het
Pogk A T 1: 166,401,942 D113E possibly damaging Het
Ptgs2 T C 1: 150,102,721 F195L probably damaging Het
Ptpn21 T A 12: 98,682,622 E925V possibly damaging Het
Ranbp2 T C 10: 58,490,648 F2714L possibly damaging Het
Rbm20 T G 19: 53,851,313 I911S possibly damaging Het
Rwdd2b A G 16: 87,436,621 V197A possibly damaging Het
Sel1l2 C G 2: 140,275,409 A181P probably damaging Het
Sf1 A G 19: 6,372,338 E234G possibly damaging Het
Skint2 A C 4: 112,626,000 T201P probably damaging Het
Sra1 C T 18: 36,676,895 R199H probably damaging Het
Svs2 A G 2: 164,237,792 M65T probably benign Het
Tgif1 C A 17: 70,846,549 probably benign Het
Tmem184c A G 8: 77,604,782 W113R possibly damaging Het
Tmem30a T C 9: 79,774,150 R282G probably benign Het
Top1 T A 2: 160,698,235 Y244* probably null Het
Trank1 A G 9: 111,392,793 Y2866C probably damaging Het
Trim7 A C 11: 48,849,519 I148L probably damaging Het
Usp30 T G 5: 114,111,184 V183G probably damaging Het
Vmn1r175 G A 7: 23,808,587 S205F probably damaging Het
Zbtb32 CTTG CTTGTTG 7: 30,591,521 probably benign Het
Zfp108 T A 7: 24,261,177 C398S probably damaging Het
Zfp592 T G 7: 81,024,192 D301E probably benign Het
Other mutations in Triml1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00768:Triml1 APN 8 43140961 splice site probably benign
IGL00920:Triml1 APN 8 43138682 missense probably damaging 1.00
IGL01319:Triml1 APN 8 43141397 utr 5 prime probably benign
IGL01323:Triml1 APN 8 43138563 splice site probably null
IGL01998:Triml1 APN 8 43141313 missense probably damaging 1.00
IGL02394:Triml1 APN 8 43138592 missense possibly damaging 0.57
R0359:Triml1 UTSW 8 43130505 missense probably damaging 1.00
R0400:Triml1 UTSW 8 43141040 missense probably benign 0.03
R1799:Triml1 UTSW 8 43130475 missense probably damaging 1.00
R2008:Triml1 UTSW 8 43130605 missense probably damaging 0.97
R2363:Triml1 UTSW 8 43141371 missense probably damaging 0.99
R2405:Triml1 UTSW 8 43130283 missense probably damaging 1.00
R5333:Triml1 UTSW 8 43130290 missense possibly damaging 0.82
R6093:Triml1 UTSW 8 43140718 missense probably benign 0.04
R6244:Triml1 UTSW 8 43138756 nonsense probably null
R6808:Triml1 UTSW 8 43141221 missense probably damaging 0.99
R6860:Triml1 UTSW 8 43130566 missense probably damaging 1.00
R7231:Triml1 UTSW 8 43136371 missense probably benign
R7826:Triml1 UTSW 8 43138766 missense possibly damaging 0.95
R8054:Triml1 UTSW 8 43130383 missense probably damaging 0.99
R8234:Triml1 UTSW 8 43141248 missense probably benign 0.25
Z1088:Triml1 UTSW 8 43130398 missense probably damaging 1.00
Z1177:Triml1 UTSW 8 43140705 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- AGCTTGAAATACTAAAAGCCACTG -3'
(R):5'- TACTCTTCACCCATCATATCAAGAT -3'

Sequencing Primer
(F):5'- TAATGGGATCTGCAACCCTG -3'
(R):5'- ATAGGACTGTTTTTGTTGCTAACATG -3'
Posted On2020-06-30