Mutagenetix > Incidental Mutations

Incidental Mutation 'R0702:Cfap69'

63047

Institutional Source

Beutler Lab

Gene Symbol

Cfap69

Ensembl Gene

ENSMUSG00000040473

Gene Name

cilia and flagella associated protein 69

Synonyms

A330021E22Rik

MMRRC Submission

038885-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0702 (G1)

Quality Score

103

Status

Not validated

Chromosome

Chromosomal Location

5579278-5664239 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 5644465 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 132 (I132T)

Ref Sequence

ENSEMBL: ENSMUSP00000143393 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054865] [ENSMUST00000061008] [ENSMUST00000132510] [ENSMUST00000135252] [ENSMUST00000196165]

Predicted Effect

probably benign
Transcript: ENSMUST00000054865
AA Change: I132T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000053206
Gene: ENSMUSG00000040473
AA Change: I132T

Domain	Start	End	E-Value	Type
low complexity region	2	16	N/A	INTRINSIC
low complexity region	847	860	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000061008
AA Change: I132T

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000051741
Gene: ENSMUSG00000040473
AA Change: I132T

Domain	Start	End	E-Value	Type
low complexity region	2	16	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000132510

SMART Domains

Protein: ENSMUSP00000122569
Gene: ENSMUSG00000040473

Domain	Start	End	E-Value	Type
low complexity region	2	16	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000135252
AA Change: I132T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000117518
Gene: ENSMUSG00000040473
AA Change: I132T

Domain	Start	End	E-Value	Type
low complexity region	2	16	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000196165
AA Change: I132T

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000143393
Gene: ENSMUSG00000040473
AA Change: I132T

Domain	Start	End	E-Value	Type
low complexity region	2	16	N/A	INTRINSIC
low complexity region	676	689	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198121

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 95.7%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit faster response kinetics and stimuli integration to olfactory stimulation and impaired olfaction a buried food pellet test with a background of the same odor. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 25 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd11	A	T	8: 122,889,766	I2428N	probably damaging	Het
Ano9	A	G	7: 141,107,282	V348A	probably damaging	Het
Chd1l	C	T	3: 97,566,794	D791N	probably benign	Het
Chl1	A	G	6: 103,706,622	Y819C	probably damaging	Het
Col5a2	T	A	1: 45,380,131	D1263V	possibly damaging	Het
Csnk1g1	C	T	9: 66,010,493	R45W	probably damaging	Het
Cul7	T	A	17: 46,663,190	L1467H	probably damaging	Het
Dgat2l6	G	A	X: 100,542,681	V180M	probably damaging	Het
Fscb	G	A	12: 64,472,001	P897L	unknown	Het
Herc6	T	C	6: 57,581,107	L24P	probably damaging	Het
Il23r	T	A	6: 67,466,285	Q278L	probably damaging	Het
Kpna4	A	T	3: 69,084,105	V361D	probably damaging	Het
Muc1	A	G	3: 89,230,220	D123G	probably benign	Het
Notch4	A	G	17: 34,575,203	Y722C	probably damaging	Het
Ntng1	G	C	3: 109,872,254	R336G	probably damaging	Het
Olfr199	T	C	16: 59,215,699	M305V	probably benign	Het
Pgbd5	C	T	8: 124,374,255	V421M	probably benign	Het
Prkdc	A	G	16: 15,785,971	T2950A	possibly damaging	Het
Proser3	A	T	7: 30,539,530	D630E	probably benign	Het
Rims4	C	T	2: 163,863,929	V262M	possibly damaging	Het
Serpina3g	A	G	12: 104,241,253	E225G	probably damaging	Het
Slc2a13	T	C	15: 91,321,667	D439G	probably benign	Het
Srebf2	T	C	15: 82,177,409	L352P	probably damaging	Het
Trpc5	A	G	X: 144,411,739	V590A	probably damaging	Het
Ubqln2	A	T	X: 153,499,669	M406L	possibly damaging	Het

Other mutations in Cfap69

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Cfap69	APN	5	5584682	missense	probably damaging	1.00
IGL00234:Cfap69	APN	5	5617295	missense	probably benign	0.03
IGL00658:Cfap69	APN	5	5625857	missense	probably damaging	1.00
IGL00901:Cfap69	APN	5	5619162	splice site	probably benign
IGL01410:Cfap69	APN	5	5646979	missense	probably damaging	1.00
IGL01415:Cfap69	APN	5	5646979	missense	probably damaging	1.00
IGL01839:Cfap69	APN	5	5626027	nonsense	probably null
IGL01993:Cfap69	APN	5	5581284	missense	probably damaging	0.99
IGL02821:Cfap69	APN	5	5664017	missense	probably benign	0.01
IGL03212:Cfap69	APN	5	5657849	critical splice acceptor site	probably null
IGL03339:Cfap69	APN	5	5586436	splice site	probably benign
IGL03052:Cfap69	UTSW	5	5589206	missense	probably damaging	0.97
R0049:Cfap69	UTSW	5	5613734	missense	probably benign	0.45
R0049:Cfap69	UTSW	5	5613734	missense	probably benign	0.45
R0387:Cfap69	UTSW	5	5589303	missense	probably damaging	0.98
R0433:Cfap69	UTSW	5	5649853	missense	probably damaging	0.99
R0690:Cfap69	UTSW	5	5663951	missense	probably damaging	0.99
R0718:Cfap69	UTSW	5	5621924	missense	probably damaging	1.00
R1525:Cfap69	UTSW	5	5640230	splice site	probably null
R1670:Cfap69	UTSW	5	5586409	missense	probably benign	0.27
R1677:Cfap69	UTSW	5	5582457	missense	probably damaging	1.00
R1857:Cfap69	UTSW	5	5582518	missense	possibly damaging	0.92
R1916:Cfap69	UTSW	5	5663970	missense	probably damaging	0.99
R1937:Cfap69	UTSW	5	5593818	missense	probably damaging	1.00
R2029:Cfap69	UTSW	5	5604306	missense	probably damaging	1.00
R2106:Cfap69	UTSW	5	5595979	missense	probably benign	0.05
R2177:Cfap69	UTSW	5	5625803	missense	probably damaging	1.00
R2261:Cfap69	UTSW	5	5596018	missense	probably damaging	0.99
R2939:Cfap69	UTSW	5	5644432	missense	probably damaging	0.99
R3706:Cfap69	UTSW	5	5613843	nonsense	probably null
R3876:Cfap69	UTSW	5	5584645	splice site	probably benign
R3893:Cfap69	UTSW	5	5581245	missense	probably damaging	1.00
R4033:Cfap69	UTSW	5	5604389	missense	possibly damaging	0.87
R4760:Cfap69	UTSW	5	5646939	missense	probably damaging	1.00
R4787:Cfap69	UTSW	5	5646934	critical splice donor site	probably null
R4932:Cfap69	UTSW	5	5625820	missense	probably damaging	1.00
R5215:Cfap69	UTSW	5	5589133	missense	possibly damaging	0.82
R5258:Cfap69	UTSW	5	5604271	splice site	probably null
R5596:Cfap69	UTSW	5	5626020	missense	probably damaging	1.00
R5673:Cfap69	UTSW	5	5596027	missense	possibly damaging	0.66
R5752:Cfap69	UTSW	5	5589204	missense	probably damaging	1.00
R5933:Cfap69	UTSW	5	5640183	missense	probably damaging	1.00
R6148:Cfap69	UTSW	5	5663996	missense	probably benign	0.03
R6511:Cfap69	UTSW	5	5617220	missense	probably damaging	0.98
R6550:Cfap69	UTSW	5	5581220	missense	probably benign	0.03
R6870:Cfap69	UTSW	5	5621958	missense	probably benign	0.26
R7455:Cfap69	UTSW	5	5625873	missense	possibly damaging	0.92
R7544:Cfap69	UTSW	5	5595936	missense	not run
R7547:Cfap69	UTSW	5	5604290	missense	possibly damaging	0.88
R7787:Cfap69	UTSW	5	5589260	missense	probably damaging	1.00
R8049:Cfap69	UTSW	5	5619085	intron	probably benign
R8110:Cfap69	UTSW	5	5582515	missense	possibly damaging	0.79
R8128:Cfap69	UTSW	5	5596034	missense	probably benign
R8306:Cfap69	UTSW	5	5604287	missense	probably benign	0.01
X0010:Cfap69	UTSW	5	5644503	splice site	probably null
Z1177:Cfap69	UTSW	5	5586384	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- TGGTTTCAGCAACTAAGCATAAGCTCAA -3'
(R):5'- ACTTTGCCACCAGCAGCATGATTT -3'

Sequencing Primer
(F):5'- aaggaaagttggatgagggg -3'
(R):5'- CACCAGCAGCATGATTTGTAAGG -3'

Posted On

2013-07-30