Incidental Mutation 'R0702:Cfap69'
ID63047
Institutional Source Beutler Lab
Gene Symbol Cfap69
Ensembl Gene ENSMUSG00000040473
Gene Namecilia and flagella associated protein 69
SynonymsA330021E22Rik
MMRRC Submission 038885-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0702 (G1)
Quality Score103
Status Not validated
Chromosome5
Chromosomal Location5579278-5664239 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5644465 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 132 (I132T)
Ref Sequence ENSEMBL: ENSMUSP00000143393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054865] [ENSMUST00000061008] [ENSMUST00000132510] [ENSMUST00000135252] [ENSMUST00000196165]
Predicted Effect probably benign
Transcript: ENSMUST00000054865
AA Change: I132T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000053206
Gene: ENSMUSG00000040473
AA Change: I132T

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 847 860 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000061008
AA Change: I132T

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000051741
Gene: ENSMUSG00000040473
AA Change: I132T

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132510
SMART Domains Protein: ENSMUSP00000122569
Gene: ENSMUSG00000040473

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135252
AA Change: I132T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000117518
Gene: ENSMUSG00000040473
AA Change: I132T

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196165
AA Change: I132T

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000143393
Gene: ENSMUSG00000040473
AA Change: I132T

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 676 689 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198121
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit faster response kinetics and stimuli integration to olfactory stimulation and impaired olfaction a buried food pellet test with a background of the same odor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd11 A T 8: 122,889,766 I2428N probably damaging Het
Ano9 A G 7: 141,107,282 V348A probably damaging Het
Chd1l C T 3: 97,566,794 D791N probably benign Het
Chl1 A G 6: 103,706,622 Y819C probably damaging Het
Col5a2 T A 1: 45,380,131 D1263V possibly damaging Het
Csnk1g1 C T 9: 66,010,493 R45W probably damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Dgat2l6 G A X: 100,542,681 V180M probably damaging Het
Fscb G A 12: 64,472,001 P897L unknown Het
Herc6 T C 6: 57,581,107 L24P probably damaging Het
Il23r T A 6: 67,466,285 Q278L probably damaging Het
Kpna4 A T 3: 69,084,105 V361D probably damaging Het
Muc1 A G 3: 89,230,220 D123G probably benign Het
Notch4 A G 17: 34,575,203 Y722C probably damaging Het
Ntng1 G C 3: 109,872,254 R336G probably damaging Het
Olfr199 T C 16: 59,215,699 M305V probably benign Het
Pgbd5 C T 8: 124,374,255 V421M probably benign Het
Prkdc A G 16: 15,785,971 T2950A possibly damaging Het
Proser3 A T 7: 30,539,530 D630E probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Serpina3g A G 12: 104,241,253 E225G probably damaging Het
Slc2a13 T C 15: 91,321,667 D439G probably benign Het
Srebf2 T C 15: 82,177,409 L352P probably damaging Het
Trpc5 A G X: 144,411,739 V590A probably damaging Het
Ubqln2 A T X: 153,499,669 M406L possibly damaging Het
Other mutations in Cfap69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Cfap69 APN 5 5584682 missense probably damaging 1.00
IGL00234:Cfap69 APN 5 5617295 missense probably benign 0.03
IGL00658:Cfap69 APN 5 5625857 missense probably damaging 1.00
IGL00901:Cfap69 APN 5 5619162 splice site probably benign
IGL01410:Cfap69 APN 5 5646979 missense probably damaging 1.00
IGL01415:Cfap69 APN 5 5646979 missense probably damaging 1.00
IGL01839:Cfap69 APN 5 5626027 nonsense probably null
IGL01993:Cfap69 APN 5 5581284 missense probably damaging 0.99
IGL02821:Cfap69 APN 5 5664017 missense probably benign 0.01
IGL03212:Cfap69 APN 5 5657849 critical splice acceptor site probably null
IGL03339:Cfap69 APN 5 5586436 splice site probably benign
IGL03052:Cfap69 UTSW 5 5589206 missense probably damaging 0.97
R0049:Cfap69 UTSW 5 5613734 missense probably benign 0.45
R0049:Cfap69 UTSW 5 5613734 missense probably benign 0.45
R0387:Cfap69 UTSW 5 5589303 missense probably damaging 0.98
R0433:Cfap69 UTSW 5 5649853 missense probably damaging 0.99
R0690:Cfap69 UTSW 5 5663951 missense probably damaging 0.99
R0718:Cfap69 UTSW 5 5621924 missense probably damaging 1.00
R1525:Cfap69 UTSW 5 5640230 splice site probably null
R1670:Cfap69 UTSW 5 5586409 missense probably benign 0.27
R1677:Cfap69 UTSW 5 5582457 missense probably damaging 1.00
R1857:Cfap69 UTSW 5 5582518 missense possibly damaging 0.92
R1916:Cfap69 UTSW 5 5663970 missense probably damaging 0.99
R1937:Cfap69 UTSW 5 5593818 missense probably damaging 1.00
R2029:Cfap69 UTSW 5 5604306 missense probably damaging 1.00
R2106:Cfap69 UTSW 5 5595979 missense probably benign 0.05
R2177:Cfap69 UTSW 5 5625803 missense probably damaging 1.00
R2261:Cfap69 UTSW 5 5596018 missense probably damaging 0.99
R2939:Cfap69 UTSW 5 5644432 missense probably damaging 0.99
R3706:Cfap69 UTSW 5 5613843 nonsense probably null
R3876:Cfap69 UTSW 5 5584645 splice site probably benign
R3893:Cfap69 UTSW 5 5581245 missense probably damaging 1.00
R4033:Cfap69 UTSW 5 5604389 missense possibly damaging 0.87
R4760:Cfap69 UTSW 5 5646939 missense probably damaging 1.00
R4787:Cfap69 UTSW 5 5646934 critical splice donor site probably null
R4932:Cfap69 UTSW 5 5625820 missense probably damaging 1.00
R5215:Cfap69 UTSW 5 5589133 missense possibly damaging 0.82
R5258:Cfap69 UTSW 5 5604271 splice site probably null
R5596:Cfap69 UTSW 5 5626020 missense probably damaging 1.00
R5673:Cfap69 UTSW 5 5596027 missense possibly damaging 0.66
R5752:Cfap69 UTSW 5 5589204 missense probably damaging 1.00
R5933:Cfap69 UTSW 5 5640183 missense probably damaging 1.00
R6148:Cfap69 UTSW 5 5663996 missense probably benign 0.03
R6511:Cfap69 UTSW 5 5617220 missense probably damaging 0.98
R6550:Cfap69 UTSW 5 5581220 missense probably benign 0.03
R6870:Cfap69 UTSW 5 5621958 missense probably benign 0.26
R7455:Cfap69 UTSW 5 5625873 missense possibly damaging 0.92
R7544:Cfap69 UTSW 5 5595936 missense not run
R7547:Cfap69 UTSW 5 5604290 missense possibly damaging 0.88
R7787:Cfap69 UTSW 5 5589260 missense probably damaging 1.00
R8049:Cfap69 UTSW 5 5619085 intron probably benign
R8110:Cfap69 UTSW 5 5582515 missense possibly damaging 0.79
R8128:Cfap69 UTSW 5 5596034 missense probably benign
R8306:Cfap69 UTSW 5 5604287 missense probably benign 0.01
X0010:Cfap69 UTSW 5 5644503 splice site probably null
Z1177:Cfap69 UTSW 5 5586384 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGGTTTCAGCAACTAAGCATAAGCTCAA -3'
(R):5'- ACTTTGCCACCAGCAGCATGATTT -3'

Sequencing Primer
(F):5'- aaggaaagttggatgagggg -3'
(R):5'- CACCAGCAGCATGATTTGTAAGG -3'
Posted On2013-07-30