Incidental Mutation 'R8100:Dsg3'
ID630483
Institutional Source Beutler Lab
Gene Symbol Dsg3
Ensembl Gene ENSMUSG00000056632
Gene Namedesmoglein 3
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.454) question?
Stock #R8100 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location20510304-20541310 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20528971 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 431 (D431G)
Ref Sequence ENSEMBL: ENSMUSP00000064718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070892]
Predicted Effect probably benign
Transcript: ENSMUST00000070892
AA Change: D431G

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000064718
Gene: ENSMUSG00000056632
AA Change: D431G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 70 155 3.9e-13 SMART
CA 179 265 2.36e-21 SMART
CA 288 382 1.55e-7 SMART
CA 409 493 6.15e-11 SMART
low complexity region 615 638 N/A INTRINSIC
low complexity region 643 657 N/A INTRINSIC
low complexity region 725 736 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Mice lacking the encoded protein exhibit loss of keratinocyte cell adhesion resulting in a phenotype that resembles that of patients with pemphigus vulgaris. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutants display runting from decreased food intake due to oropharyngeal epithelial lesions, blisters around snout and eyes, hair loss by weaning, and hair regrowth with bald patches throughout life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 G A 14: 55,772,265 Q777* probably null Het
Art1 T C 7: 102,107,198 S199P probably damaging Het
Cadps2 A T 6: 23,838,809 M110K probably damaging Het
Cdk13 C T 13: 17,803,516 R379Q unknown Het
Cdk7 T C 13: 100,706,417 I272V probably benign Het
Cep350 T C 1: 155,953,402 D192G probably damaging Het
Chrna6 C T 8: 27,413,816 probably benign Het
Ciart G A 3: 95,881,344 P61L probably damaging Het
Ckmt1 T A 2: 121,360,777 D223E probably benign Het
Col6a5 C T 9: 105,878,640 R2195H probably damaging Het
D430041D05Rik C T 2: 104,256,942 R563H probably benign Het
Defa29 A T 8: 21,326,974 M1K probably null Het
Dnah11 A G 12: 117,966,633 S3326P probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Ell3 TCTCCTC TCTC 2: 121,439,456 probably benign Het
Fbln1 T A 15: 85,285,156 F699I probably damaging Het
Fndc1 A G 17: 7,771,853 S1004P unknown Het
Gpr15 T A 16: 58,717,713 T338S probably benign Het
Grin2d T C 7: 45,833,747 Y1002C unknown Het
Hk2 C T 6: 82,730,878 M703I probably benign Het
Ifi213 A C 1: 173,595,182 L39R probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Lama2 C A 10: 27,041,117 A2271S probably benign Het
Lmo7 A T 14: 101,900,463 Q867L probably benign Het
Loxhd1 T A 18: 77,404,816 S1427T possibly damaging Het
Lzts1 A G 8: 69,140,745 V70A probably damaging Het
Mocs3 A G 2: 168,231,337 T235A possibly damaging Het
Myo15 G A 11: 60,517,190 R3168H probably damaging Het
Ndc1 A G 4: 107,383,605 D260G possibly damaging Het
Nfam1 T C 15: 83,016,529 D44G probably damaging Het
Olfr1256 G A 2: 89,835,685 Q87* probably null Het
Osbpl10 G A 9: 115,167,254 R128H probably benign Het
Otx1 C A 11: 21,999,392 V29L probably benign Het
Pogk A T 1: 166,401,942 D113E possibly damaging Het
Ptgs2 T C 1: 150,102,721 F195L probably damaging Het
Ptpn21 T A 12: 98,682,622 E925V possibly damaging Het
Ranbp2 T C 10: 58,490,648 F2714L possibly damaging Het
Rbm20 T G 19: 53,851,313 I911S possibly damaging Het
Rwdd2b A G 16: 87,436,621 V197A possibly damaging Het
Sel1l2 C G 2: 140,275,409 A181P probably damaging Het
Sf1 A G 19: 6,372,338 E234G possibly damaging Het
Skint2 A C 4: 112,626,000 T201P probably damaging Het
Sra1 C T 18: 36,676,895 R199H probably damaging Het
Svs2 A G 2: 164,237,792 M65T probably benign Het
Tgif1 C A 17: 70,846,549 probably benign Het
Tmem184c A G 8: 77,604,782 W113R possibly damaging Het
Tmem30a T C 9: 79,774,150 R282G probably benign Het
Top1 T A 2: 160,698,235 Y244* probably null Het
Trank1 A G 9: 111,392,793 Y2866C probably damaging Het
Trim7 A C 11: 48,849,519 I148L probably damaging Het
Triml1 T A 8: 43,138,680 M214L probably benign Het
Usp30 T G 5: 114,111,184 V183G probably damaging Het
Vmn1r175 G A 7: 23,808,587 S205F probably damaging Het
Zbtb32 CTTG CTTGTTG 7: 30,591,521 probably benign Het
Zfp108 T A 7: 24,261,177 C398S probably damaging Het
Zfp592 T G 7: 81,024,192 D301E probably benign Het
Other mutations in Dsg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Dsg3 APN 18 20539654 missense probably damaging 1.00
IGL00697:Dsg3 APN 18 20524689 critical splice donor site probably null
IGL00966:Dsg3 APN 18 20523607 missense probably benign 0.02
IGL01352:Dsg3 APN 18 20523696 missense probably benign 0.25
IGL01953:Dsg3 APN 18 20525304 missense probably damaging 1.00
IGL02385:Dsg3 APN 18 20527714 missense probably damaging 1.00
IGL02622:Dsg3 APN 18 20528947 splice site probably benign
IGL02643:Dsg3 APN 18 20528955 missense probably benign 0.00
IGL02740:Dsg3 APN 18 20527708 missense possibly damaging 0.93
IGL03012:Dsg3 APN 18 20537243 critical splice acceptor site probably null
IGL03026:Dsg3 APN 18 20536972 splice site probably null
IGL03063:Dsg3 APN 18 20533368 splice site probably benign
IGL03098:Dsg3 APN 18 20510365 utr 5 prime probably benign
IGL03132:Dsg3 APN 18 20524596 missense probably damaging 1.00
IGL03352:Dsg3 APN 18 20527632 missense probably benign
P0035:Dsg3 UTSW 18 20539969 missense probably benign 0.05
R0039:Dsg3 UTSW 18 20521484 missense probably benign 0.36
R0099:Dsg3 UTSW 18 20540022 missense probably benign 0.01
R0109:Dsg3 UTSW 18 20540134 missense probably damaging 0.96
R0109:Dsg3 UTSW 18 20540134 missense probably damaging 0.96
R0143:Dsg3 UTSW 18 20536825 missense probably damaging 1.00
R0194:Dsg3 UTSW 18 20540142 missense probably damaging 1.00
R0373:Dsg3 UTSW 18 20539747 missense probably damaging 1.00
R0517:Dsg3 UTSW 18 20529025 missense probably benign 0.06
R0521:Dsg3 UTSW 18 20527815 missense possibly damaging 0.53
R1194:Dsg3 UTSW 18 20525220 missense probably damaging 0.98
R1551:Dsg3 UTSW 18 20536918 missense possibly damaging 0.84
R1762:Dsg3 UTSW 18 20539732 missense probably damaging 1.00
R1957:Dsg3 UTSW 18 20522105 missense probably damaging 1.00
R2061:Dsg3 UTSW 18 20527737 nonsense probably null
R2071:Dsg3 UTSW 18 20536825 missense probably damaging 1.00
R2513:Dsg3 UTSW 18 20523662 missense possibly damaging 0.48
R2571:Dsg3 UTSW 18 20540005 missense probably benign 0.01
R2945:Dsg3 UTSW 18 20539935 missense probably benign
R2968:Dsg3 UTSW 18 20525225 missense possibly damaging 0.75
R3906:Dsg3 UTSW 18 20538499 missense probably damaging 1.00
R4616:Dsg3 UTSW 18 20531559 missense probably benign
R4641:Dsg3 UTSW 18 20520558 missense probably benign 0.28
R4685:Dsg3 UTSW 18 20539736 missense probably benign 0.08
R5690:Dsg3 UTSW 18 20522051 missense probably benign 0.01
R5786:Dsg3 UTSW 18 20521571 missense possibly damaging 0.46
R5950:Dsg3 UTSW 18 20538529 missense probably damaging 1.00
R6131:Dsg3 UTSW 18 20538512 missense probably damaging 0.99
R6131:Dsg3 UTSW 18 20520477 splice site probably null
R6243:Dsg3 UTSW 18 20539724 missense probably damaging 1.00
R6315:Dsg3 UTSW 18 20524586 missense probably benign 0.08
R6327:Dsg3 UTSW 18 20539870 missense probably benign
R6418:Dsg3 UTSW 18 20523760 critical splice donor site probably null
R6464:Dsg3 UTSW 18 20533526 missense probably benign 0.00
R6497:Dsg3 UTSW 18 20537248 missense probably benign 0.33
R6518:Dsg3 UTSW 18 20533422 missense probably benign 0.23
R6551:Dsg3 UTSW 18 20539911 missense unknown
R6685:Dsg3 UTSW 18 20520615 critical splice donor site probably null
R6952:Dsg3 UTSW 18 20525159 missense possibly damaging 0.77
R7357:Dsg3 UTSW 18 20539783 missense probably damaging 1.00
R7385:Dsg3 UTSW 18 20540197 missense possibly damaging 0.52
R7456:Dsg3 UTSW 18 20531363 missense probably benign 0.17
R7506:Dsg3 UTSW 18 20533464 missense probably benign 0.31
R7570:Dsg3 UTSW 18 20527780 missense possibly damaging 0.95
R7980:Dsg3 UTSW 18 20531360 missense probably benign 0.00
R8147:Dsg3 UTSW 18 20540073 missense probably benign
R8242:Dsg3 UTSW 18 20536923 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GATCATGCATAAATATGTTGACTGTGT -3'
(R):5'- TGGAAGAAATGCTATTTGAAGTAAGA -3'

Sequencing Primer
(F):5'- TGGTGACTCACAACGATCTG -3'
(R):5'- GTAGAATCTCGGTCGATGT -3'
Posted On2020-06-30