Incidental Mutation 'R8100:Rbm20'
ID630487
Institutional Source Beutler Lab
Gene Symbol Rbm20
Ensembl Gene ENSMUSG00000043639
Gene NameRNA binding motif protein 20
Synonyms2010003H22Rik, 1110018J23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R8100 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location53677306-53867080 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 53851313 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 911 (I911S)
Ref Sequence ENSEMBL: ENSMUSP00000129447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164202]
Predicted Effect
SMART Domains Protein: ENSMUSP00000124363
Gene: ENSMUSG00000043639
AA Change: I286S

DomainStartEndE-ValueType
low complexity region 10 33 N/A INTRINSIC
low complexity region 180 191 N/A INTRINSIC
low complexity region 209 220 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164202
AA Change: I911S

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129447
Gene: ENSMUSG00000043639
AA Change: I911S

DomainStartEndE-ValueType
low complexity region 25 61 N/A INTRINSIC
low complexity region 106 117 N/A INTRINSIC
low complexity region 170 183 N/A INTRINSIC
low complexity region 251 260 N/A INTRINSIC
ZnF_U1 410 444 6.79e-1 SMART
ZnF_C2H2 413 437 4.69e0 SMART
RRM 521 591 4.01e-5 SMART
low complexity region 634 657 N/A INTRINSIC
low complexity region 804 815 N/A INTRINSIC
low complexity region 833 844 N/A INTRINSIC
ZnF_U1 1130 1165 7.26e-6 SMART
ZnF_C2H2 1133 1158 3.13e1 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds RNA and regulates splicing. Mutations in this gene have been associated with familial dilated cardiomyopathy. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for an allele lacking the RNA recognition motif exhibit increased titin compliance, and attenuated Frank-Starling mechanism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 G A 14: 55,772,265 Q777* probably null Het
Art1 T C 7: 102,107,198 S199P probably damaging Het
Cadps2 A T 6: 23,838,809 M110K probably damaging Het
Cdk13 C T 13: 17,803,516 R379Q unknown Het
Cdk7 T C 13: 100,706,417 I272V probably benign Het
Cep350 T C 1: 155,953,402 D192G probably damaging Het
Chrna6 C T 8: 27,413,816 probably benign Het
Ciart G A 3: 95,881,344 P61L probably damaging Het
Ckmt1 T A 2: 121,360,777 D223E probably benign Het
Col6a5 C T 9: 105,878,640 R2195H probably damaging Het
D430041D05Rik C T 2: 104,256,942 R563H probably benign Het
Defa29 A T 8: 21,326,974 M1K probably null Het
Dnah11 A G 12: 117,966,633 S3326P probably damaging Het
Dsg3 A G 18: 20,528,971 D431G probably benign Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Ell3 TCTCCTC TCTC 2: 121,439,456 probably benign Het
Fbln1 T A 15: 85,285,156 F699I probably damaging Het
Fndc1 A G 17: 7,771,853 S1004P unknown Het
Gpr15 T A 16: 58,717,713 T338S probably benign Het
Grin2d T C 7: 45,833,747 Y1002C unknown Het
Hk2 C T 6: 82,730,878 M703I probably benign Het
Ifi213 A C 1: 173,595,182 L39R probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Lama2 C A 10: 27,041,117 A2271S probably benign Het
Lmo7 A T 14: 101,900,463 Q867L probably benign Het
Loxhd1 T A 18: 77,404,816 S1427T possibly damaging Het
Lzts1 A G 8: 69,140,745 V70A probably damaging Het
Mocs3 A G 2: 168,231,337 T235A possibly damaging Het
Myo15 G A 11: 60,517,190 R3168H probably damaging Het
Ndc1 A G 4: 107,383,605 D260G possibly damaging Het
Nfam1 T C 15: 83,016,529 D44G probably damaging Het
Olfr1256 G A 2: 89,835,685 Q87* probably null Het
Osbpl10 G A 9: 115,167,254 R128H probably benign Het
Otx1 C A 11: 21,999,392 V29L probably benign Het
Pogk A T 1: 166,401,942 D113E possibly damaging Het
Ptgs2 T C 1: 150,102,721 F195L probably damaging Het
Ptpn21 T A 12: 98,682,622 E925V possibly damaging Het
Ranbp2 T C 10: 58,490,648 F2714L possibly damaging Het
Rwdd2b A G 16: 87,436,621 V197A possibly damaging Het
Sel1l2 C G 2: 140,275,409 A181P probably damaging Het
Sf1 A G 19: 6,372,338 E234G possibly damaging Het
Skint2 A C 4: 112,626,000 T201P probably damaging Het
Sra1 C T 18: 36,676,895 R199H probably damaging Het
Svs2 A G 2: 164,237,792 M65T probably benign Het
Tgif1 C A 17: 70,846,549 probably benign Het
Tmem184c A G 8: 77,604,782 W113R possibly damaging Het
Tmem30a T C 9: 79,774,150 R282G probably benign Het
Top1 T A 2: 160,698,235 Y244* probably null Het
Trank1 A G 9: 111,392,793 Y2866C probably damaging Het
Trim7 A C 11: 48,849,519 I148L probably damaging Het
Triml1 T A 8: 43,138,680 M214L probably benign Het
Usp30 T G 5: 114,111,184 V183G probably damaging Het
Vmn1r175 G A 7: 23,808,587 S205F probably damaging Het
Zbtb32 CTTG CTTGTTG 7: 30,591,521 probably benign Het
Zfp108 T A 7: 24,261,177 C398S probably damaging Het
Zfp592 T G 7: 81,024,192 D301E probably benign Het
Other mutations in Rbm20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Rbm20 APN 19 53843264 missense probably damaging 1.00
IGL00815:Rbm20 APN 19 53815517 missense probably damaging 1.00
IGL00845:Rbm20 APN 19 53817949 missense probably damaging 1.00
IGL01408:Rbm20 APN 19 53851613 missense possibly damaging 0.95
IGL01663:Rbm20 APN 19 53840995 missense probably damaging 1.00
IGL01902:Rbm20 APN 19 53840991 missense probably damaging 0.99
IGL01942:Rbm20 APN 19 53813443 missense probably damaging 1.00
IGL02964:Rbm20 APN 19 53813702 missense probably benign 0.02
IGL03326:Rbm20 APN 19 53814000 missense possibly damaging 0.85
BB001:Rbm20 UTSW 19 53677585 missense possibly damaging 0.63
BB002:Rbm20 UTSW 19 53813322 missense probably damaging 0.97
BB011:Rbm20 UTSW 19 53677585 missense possibly damaging 0.63
BB012:Rbm20 UTSW 19 53813322 missense probably damaging 0.97
R0326:Rbm20 UTSW 19 53864165 missense probably damaging 1.00
R0487:Rbm20 UTSW 19 53851195 missense probably damaging 1.00
R0965:Rbm20 UTSW 19 53859401 missense probably damaging 1.00
R1435:Rbm20 UTSW 19 53814157 missense probably benign 0.16
R1914:Rbm20 UTSW 19 53864087 missense probably damaging 1.00
R1915:Rbm20 UTSW 19 53864087 missense probably damaging 1.00
R2011:Rbm20 UTSW 19 53859428 missense probably damaging 1.00
R2012:Rbm20 UTSW 19 53859428 missense probably damaging 1.00
R2258:Rbm20 UTSW 19 53851741 missense probably benign
R3947:Rbm20 UTSW 19 53813337 missense probably benign 0.35
R4305:Rbm20 UTSW 19 53843260 missense probably damaging 1.00
R4308:Rbm20 UTSW 19 53843260 missense probably damaging 1.00
R4521:Rbm20 UTSW 19 53817202 missense probably benign 0.14
R4970:Rbm20 UTSW 19 53851669 missense probably damaging 0.99
R5266:Rbm20 UTSW 19 53813387 missense probably damaging 1.00
R5475:Rbm20 UTSW 19 53834705 nonsense probably null
R5503:Rbm20 UTSW 19 53851354 missense possibly damaging 0.75
R5995:Rbm20 UTSW 19 53851267 missense possibly damaging 0.95
R6836:Rbm20 UTSW 19 53814069 missense probably damaging 0.98
R6947:Rbm20 UTSW 19 53851265 missense probably damaging 1.00
R7030:Rbm20 UTSW 19 53834766 missense probably damaging 1.00
R7117:Rbm20 UTSW 19 53851558 missense possibly damaging 0.92
R7237:Rbm20 UTSW 19 53851499 missense probably benign 0.04
R7638:Rbm20 UTSW 19 53814333 missense possibly damaging 0.95
R7792:Rbm20 UTSW 19 53850136 missense probably benign
R7823:Rbm20 UTSW 19 53843354 missense probably benign 0.33
R7924:Rbm20 UTSW 19 53677585 missense possibly damaging 0.63
R7925:Rbm20 UTSW 19 53813322 missense probably damaging 0.97
R8044:Rbm20 UTSW 19 53817971 missense probably benign 0.44
R8045:Rbm20 UTSW 19 53817971 missense probably benign 0.44
R8046:Rbm20 UTSW 19 53817971 missense probably benign 0.44
R8292:Rbm20 UTSW 19 53851499 missense possibly damaging 0.71
R8366:Rbm20 UTSW 19 53850181 missense possibly damaging 0.95
RF016:Rbm20 UTSW 19 53813732 missense probably benign 0.00
Z1177:Rbm20 UTSW 19 53851685 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTGACGTTTGAGTATTCTAAGCC -3'
(R):5'- ATTTAGGCCAGGCATCTCCAG -3'

Sequencing Primer
(F):5'- TGAGTATTCTAAGCCACCATATGAC -3'
(R):5'- ATCTCCAGGTCCGTGTCATTGG -3'
Posted On2020-06-30