Incidental Mutation 'R8101:Unc13b'
ID630497
Institutional Source Beutler Lab
Gene Symbol Unc13b
Ensembl Gene ENSMUSG00000028456
Gene Nameunc-13 homolog B (C. elegans)
SynonymsUnc13h2, Munc13-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.387) question?
Stock #R8101 (G1)
Quality Score189.009
Status Not validated
Chromosome4
Chromosomal Location43058953-43264871 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43239918 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 746 (E746G)
Ref Sequence ENSEMBL: ENSMUSP00000103586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079978] [ENSMUST00000107952] [ENSMUST00000107953] [ENSMUST00000163653] [ENSMUST00000207569] [ENSMUST00000207708]
Predicted Effect probably benign
Transcript: ENSMUST00000079978
AA Change: E734G

PolyPhen 2 Score 0.371 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000078894
Gene: ENSMUSG00000028456
AA Change: E734G

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 179 193 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 322 333 N/A INTRINSIC
C1 478 527 4.21e-18 SMART
C2 601 708 2.07e-22 SMART
DUF1041 917 1021 2.02e-53 SMART
Pfam:Membr_traf_MHD 1262 1404 4.8e-60 PFAM
C2 1438 1544 7.56e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107952
AA Change: E746G

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000103586
Gene: ENSMUSG00000028456
AA Change: E746G

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 191 205 N/A INTRINSIC
low complexity region 304 315 N/A INTRINSIC
low complexity region 334 345 N/A INTRINSIC
C1 490 539 4.21e-18 SMART
C2 613 720 2.07e-22 SMART
DUF1041 929 1033 2.02e-53 SMART
Pfam:Membr_traf_MHD 1274 1416 4.8e-60 PFAM
C2 1450 1556 7.56e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107953
AA Change: E734G

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000103587
Gene: ENSMUSG00000028456
AA Change: E734G

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 179 193 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 322 333 N/A INTRINSIC
C1 478 527 4.21e-18 SMART
C2 601 708 2.07e-22 SMART
DUF1041 917 1021 2.02e-53 SMART
Pfam:Membr_traf_MHD 1263 1403 2.3e-56 PFAM
C2 1457 1563 7.56e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163653
AA Change: E746G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000128608
Gene: ENSMUSG00000028456
AA Change: E746G

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 191 205 N/A INTRINSIC
low complexity region 304 315 N/A INTRINSIC
low complexity region 334 345 N/A INTRINSIC
C1 490 539 4.21e-18 SMART
C2 613 720 2.07e-22 SMART
DUF1041 929 1032 4.64e-53 SMART
Pfam:Membr_traf_MHD 1273 1415 4.8e-60 PFAM
C2 1449 1555 7.56e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168032
SMART Domains Protein: ENSMUSP00000132622
Gene: ENSMUSG00000028456

DomainStartEndE-ValueType
C1 147 196 4.21e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000207569
AA Change: E3534G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000207708
AA Change: E1107G

PolyPhen 2 Score 0.142 (Sensitivity: 0.92; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is expressed in the kidney cortical epithelial cells and is upregulated by hyperglycemia. The encoded protein shares a high level of similarity to the rat homolog, and contains 3 C2 domains and a diacylglycerol-binding C1 domain. Hyperglycemia increases the levels of diacylglycerol, which has been shown to induce apoptosis in cells transfected with this gene and thus contribute to the renal cell complications of hyperglycemia. Studies in other species also indicate a role for this protein in the priming step of synaptic vesicle exocytosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are grossly phenotypically normal. Mice older than 12 months will exhibit sporadic seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,008,502 K3388E probably damaging Het
Aldh3b2 A T 19: 3,978,134 Q92L probably benign Het
Arhgap35 A T 7: 16,562,319 D940E probably benign Het
BC067074 C T 13: 113,320,891 T1157I Het
Birc3 A C 9: 7,861,004 S104R probably benign Het
Bloc1s4 A G 5: 36,748,141 F169L probably benign Het
Cacna1s C T 1: 136,118,665 S1725F probably benign Het
Cadm2 A T 16: 66,812,842 S139R possibly damaging Het
Ccdc188 G T 16: 18,218,012 R17L probably benign Het
Cfap54 T C 10: 92,884,796 T2599A unknown Het
Ddx10 T C 9: 53,225,520 K364R probably damaging Het
Dlgap2 T C 8: 14,831,600 C891R probably benign Het
Dnah17 T A 11: 118,125,918 Y269F probably benign Het
Dock1 A G 7: 134,999,288 D984G possibly damaging Het
Dyrk4 T A 6: 126,891,649 T297S possibly damaging Het
Efemp2 C T 19: 5,476,218 Q124* probably null Het
Erich3 A G 3: 154,733,513 E264G probably damaging Het
Fam208a A G 14: 27,442,481 D248G possibly damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Got1l1 G T 8: 27,200,302 L114I possibly damaging Het
Gpr139 A G 7: 119,184,287 C30R probably benign Het
Gstt4 T C 10: 75,818,514 I113V probably benign Het
Hmcn2 C A 2: 31,350,070 Q458K probably benign Het
Hr G A 14: 70,567,842 S1008N possibly damaging Het
Kif14 C T 1: 136,476,352 L525F probably benign Het
Lama1 A T 17: 67,745,922 I417F Het
Limd1 A T 9: 123,500,151 K469* probably null Het
Lipo2 T C 19: 33,720,994 M328V possibly damaging Het
Lrrk1 T C 7: 66,342,782 S81G probably benign Het
Ltn1 G A 16: 87,418,497 R417W probably damaging Het
Mamdc2 T C 19: 23,334,029 D487G probably damaging Het
Mmp3 A C 9: 7,446,985 K55T probably benign Het
Mob1b A G 5: 88,753,234 I167V probably benign Het
Mocs3 A G 2: 168,231,881 N416S probably damaging Het
Mtrr A G 13: 68,577,621 F123S probably damaging Het
Muc5b A G 7: 141,865,175 T3953A possibly damaging Het
Myh7 G A 14: 54,973,319 Q1714* probably null Het
Nrf1 A G 6: 30,098,450 K114E possibly damaging Het
Olfr275 A G 4: 52,825,849 T151A probably benign Het
Olfr288 A T 15: 98,186,958 S280T probably benign Het
Olfr822 A G 10: 130,075,006 I199V probably benign Het
Prob1 T C 18: 35,653,233 D656G possibly damaging Het
Rbm24 A T 13: 46,428,968 Y121F probably benign Het
Rbm24 C T 13: 46,429,291 Q229* probably null Het
Rd3l C T 12: 111,980,052 V97I probably benign Het
Rere G A 4: 150,617,339 R25H probably damaging Het
Rgs20 T C 1: 4,912,415 M144V probably benign Het
Robo1 A G 16: 72,978,581 I665V probably benign Het
Slc18b1 T C 10: 23,822,943 L339S probably damaging Het
Slc25a17 G A 15: 81,338,047 L75F probably damaging Het
Snx29 A G 16: 11,571,716 N226D probably benign Het
Tmprss11b A G 5: 86,664,962 probably null Het
Tpp2 T C 1: 43,970,440 V478A probably damaging Het
Urb2 A G 8: 124,028,040 E162G probably benign Het
Vwf C T 6: 125,570,559 Q198* probably null Het
Zhx3 T C 2: 160,781,699 M183V probably damaging Het
Other mutations in Unc13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Unc13b APN 4 43240285 missense probably damaging 1.00
IGL00832:Unc13b APN 4 43258921 missense probably damaging 1.00
IGL01111:Unc13b APN 4 43096927 missense possibly damaging 0.76
IGL01115:Unc13b APN 4 43258492 missense probably damaging 1.00
IGL01137:Unc13b APN 4 43091291 missense probably damaging 1.00
IGL01637:Unc13b APN 4 43241066 missense probably damaging 1.00
IGL01789:Unc13b APN 4 43239462 missense probably damaging 1.00
IGL01792:Unc13b APN 4 43250218 missense probably damaging 0.99
IGL01877:Unc13b APN 4 43249583 critical splice donor site probably null
IGL01924:Unc13b APN 4 43239385 nonsense probably null
IGL02087:Unc13b APN 4 43091270 missense probably null 1.00
IGL02197:Unc13b APN 4 43165828 missense probably damaging 0.99
IGL02504:Unc13b APN 4 43263031 missense probably damaging 1.00
IGL02659:Unc13b APN 4 43235332 missense probably damaging 1.00
IGL03031:Unc13b APN 4 43235368 missense probably damaging 1.00
IGL03036:Unc13b APN 4 43235249 missense probably damaging 1.00
IGL03209:Unc13b APN 4 43239351 missense probably damaging 0.99
IGL03352:Unc13b APN 4 43237110 missense possibly damaging 0.90
BB006:Unc13b UTSW 4 43174399 missense unknown
BB016:Unc13b UTSW 4 43174399 missense unknown
G1Funyon:Unc13b UTSW 4 43263568 missense probably benign
P0028:Unc13b UTSW 4 43256225 missense probably damaging 1.00
PIT4585001:Unc13b UTSW 4 43091298 missense probably benign 0.03
R0019:Unc13b UTSW 4 43096990 missense possibly damaging 0.58
R0019:Unc13b UTSW 4 43096990 missense possibly damaging 0.58
R0335:Unc13b UTSW 4 43236983 missense possibly damaging 0.95
R0504:Unc13b UTSW 4 43263559 missense probably damaging 0.99
R0631:Unc13b UTSW 4 43182849 missense possibly damaging 0.47
R0748:Unc13b UTSW 4 43241164 splice site probably benign
R1275:Unc13b UTSW 4 43235366 missense probably damaging 1.00
R1293:Unc13b UTSW 4 43235190 missense probably damaging 1.00
R1434:Unc13b UTSW 4 43239385 nonsense probably null
R1552:Unc13b UTSW 4 43237144 missense probably damaging 0.99
R1591:Unc13b UTSW 4 43244747 missense probably damaging 1.00
R1628:Unc13b UTSW 4 43263371 missense probably damaging 1.00
R1740:Unc13b UTSW 4 43240285 missense probably damaging 1.00
R1839:Unc13b UTSW 4 43258308 splice site probably benign
R2045:Unc13b UTSW 4 43091266 missense probably damaging 1.00
R2191:Unc13b UTSW 4 43245566 nonsense probably null
R2259:Unc13b UTSW 4 43182780 missense possibly damaging 0.87
R2307:Unc13b UTSW 4 43239854 missense probably damaging 0.98
R2317:Unc13b UTSW 4 43245514 missense probably damaging 1.00
R2402:Unc13b UTSW 4 43095843 missense probably benign
R2847:Unc13b UTSW 4 43180404 missense probably benign 0.04
R3414:Unc13b UTSW 4 43234658 splice site probably benign
R3436:Unc13b UTSW 4 43097028 splice site probably benign
R3955:Unc13b UTSW 4 43256834 missense probably damaging 1.00
R3957:Unc13b UTSW 4 43256834 missense probably damaging 1.00
R4015:Unc13b UTSW 4 43237801 missense probably damaging 1.00
R4650:Unc13b UTSW 4 43261035 missense probably damaging 0.97
R4836:Unc13b UTSW 4 43237137 missense probably damaging 1.00
R5041:Unc13b UTSW 4 43237836 missense probably benign 0.41
R5413:Unc13b UTSW 4 43257936 critical splice donor site probably null
R5994:Unc13b UTSW 4 43172596 intron probably benign
R6015:Unc13b UTSW 4 43177995 nonsense probably null
R6090:Unc13b UTSW 4 43239306 missense probably damaging 1.00
R6242:Unc13b UTSW 4 43165800 missense possibly damaging 0.92
R6246:Unc13b UTSW 4 43216246 missense probably benign 0.18
R6427:Unc13b UTSW 4 43176966 unclassified probably benign
R6660:Unc13b UTSW 4 43177412 unclassified probably benign
R6670:Unc13b UTSW 4 43255562 missense probably damaging 0.99
R6753:Unc13b UTSW 4 43239331 missense probably damaging 1.00
R6858:Unc13b UTSW 4 43165828 missense possibly damaging 0.85
R6886:Unc13b UTSW 4 43170156 intron probably benign
R6969:Unc13b UTSW 4 43263538 missense possibly damaging 0.94
R6994:Unc13b UTSW 4 43171403 intron probably benign
R6994:Unc13b UTSW 4 43173203 intron probably benign
R7080:Unc13b UTSW 4 43171926 missense unknown
R7117:Unc13b UTSW 4 43216544 missense probably benign 0.33
R7132:Unc13b UTSW 4 43215757 missense probably benign 0.17
R7181:Unc13b UTSW 4 43258893 missense probably damaging 0.99
R7192:Unc13b UTSW 4 43258519 missense probably damaging 1.00
R7246:Unc13b UTSW 4 43172910 missense unknown
R7342:Unc13b UTSW 4 43258703 missense probably damaging 0.99
R7345:Unc13b UTSW 4 43173966 missense unknown
R7355:Unc13b UTSW 4 43237754 missense probably damaging 1.00
R7391:Unc13b UTSW 4 43216459 missense probably benign 0.03
R7419:Unc13b UTSW 4 43174023 missense unknown
R7424:Unc13b UTSW 4 43172235 missense unknown
R7517:Unc13b UTSW 4 43215765 missense probably benign
R7532:Unc13b UTSW 4 43249565 missense probably benign 0.44
R7564:Unc13b UTSW 4 43091258 missense probably damaging 1.00
R7598:Unc13b UTSW 4 43263569 missense probably benign 0.20
R7604:Unc13b UTSW 4 43170102 missense unknown
R7604:Unc13b UTSW 4 43256776 missense possibly damaging 0.95
R7643:Unc13b UTSW 4 43216333 missense probably benign
R7718:Unc13b UTSW 4 43173854 missense unknown
R7735:Unc13b UTSW 4 43165791 missense probably damaging 1.00
R7756:Unc13b UTSW 4 43177312 small deletion probably benign
R7757:Unc13b UTSW 4 43177312 small deletion probably benign
R7757:Unc13b UTSW 4 43177330 small insertion probably benign
R7757:Unc13b UTSW 4 43177341 small insertion probably benign
R7758:Unc13b UTSW 4 43177312 small insertion probably benign
R7758:Unc13b UTSW 4 43177344 small insertion probably benign
R7781:Unc13b UTSW 4 43259546 missense possibly damaging 0.87
R7793:Unc13b UTSW 4 43172737 missense unknown
R7858:Unc13b UTSW 4 43176285 missense unknown
R7867:Unc13b UTSW 4 43232573 nonsense probably null
R7897:Unc13b UTSW 4 43171860 missense unknown
R7904:Unc13b UTSW 4 43217075 missense probably benign
R7929:Unc13b UTSW 4 43174399 missense unknown
R7984:Unc13b UTSW 4 43173973 missense unknown
R8069:Unc13b UTSW 4 43177597 missense unknown
R8246:Unc13b UTSW 4 43175954 missense unknown
R8289:Unc13b UTSW 4 43172524 nonsense probably null
R8301:Unc13b UTSW 4 43263568 missense probably benign
R8397:Unc13b UTSW 4 43217290 missense probably benign 0.12
R8421:Unc13b UTSW 4 43178304 missense unknown
R8738:Unc13b UTSW 4 43177564 missense unknown
R8746:Unc13b UTSW 4 43176120 missense unknown
R8766:Unc13b UTSW 4 43174722 missense unknown
R8834:Unc13b UTSW 4 43175954 missense unknown
R8862:Unc13b UTSW 4 43235207 missense probably damaging 1.00
R8864:Unc13b UTSW 4 43174724 missense unknown
R8889:Unc13b UTSW 4 43176484 missense unknown
R8892:Unc13b UTSW 4 43176484 missense unknown
RF016:Unc13b UTSW 4 43177347 small insertion probably benign
RF016:Unc13b UTSW 4 43177350 small insertion probably benign
RF041:Unc13b UTSW 4 43177338 small insertion probably benign
RF056:Unc13b UTSW 4 43177359 small insertion probably benign
Z1176:Unc13b UTSW 4 43171419 missense unknown
Z1176:Unc13b UTSW 4 43177191 missense unknown
Z1176:Unc13b UTSW 4 43177764 missense unknown
Z1176:Unc13b UTSW 4 43261043 missense probably benign 0.11
Z1177:Unc13b UTSW 4 43173669 missense unknown
Predicted Primers PCR Primer
(F):5'- TGGAGAATATGTGGCCACTTGG -3'
(R):5'- ACTGCTCAGTTCTTCCAGGG -3'

Sequencing Primer
(F):5'- GCTTGGTGCCATTTCCCC -3'
(R):5'- AATGGTCTGGTCCCTCAGAGTAC -3'
Posted On2020-06-30