Incidental Mutation 'R8101:Arhgap35'
ID630506
Institutional Source Beutler Lab
Gene Symbol Arhgap35
Ensembl Gene ENSMUSG00000058230
Gene NameRho GTPase activating protein 35
Synonymsp190RhoGAP, p190A, Grlf1, P190 RhoGAP, 6430596G11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8101 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location16493719-16614993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 16562319 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 940 (D940E)
Ref Sequence ENSEMBL: ENSMUSP00000075242 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075845] [ENSMUST00000171937]
Predicted Effect probably benign
Transcript: ENSMUST00000075845
AA Change: D940E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000075242
Gene: ENSMUSG00000058230
AA Change: D940E

DomainStartEndE-ValueType
Pfam:Ras 154 249 6.1e-7 PFAM
FF 270 327 5.76e-9 SMART
FF 369 422 1.1e-5 SMART
FF 429 483 7.43e-12 SMART
FF 485 539 2.02e-4 SMART
Blast:RhoGAP 733 796 1e-7 BLAST
low complexity region 1037 1048 N/A INTRINSIC
low complexity region 1214 1225 N/A INTRINSIC
low complexity region 1227 1235 N/A INTRINSIC
RhoGAP 1259 1433 8.14e-72 SMART
low complexity region 1444 1457 N/A INTRINSIC
low complexity region 1462 1494 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171937
AA Change: D940E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000127379
Gene: ENSMUSG00000058230
AA Change: D940E

DomainStartEndE-ValueType
Pfam:Ras 154 249 6e-7 PFAM
FF 270 327 5.76e-9 SMART
FF 369 422 1.1e-5 SMART
FF 429 483 7.43e-12 SMART
FF 485 539 2.02e-4 SMART
Blast:RhoGAP 733 796 1e-7 BLAST
low complexity region 1037 1048 N/A INTRINSIC
low complexity region 1214 1225 N/A INTRINSIC
low complexity region 1227 1235 N/A INTRINSIC
RhoGAP 1259 1433 8.14e-72 SMART
low complexity region 1444 1457 N/A INTRINSIC
low complexity region 1462 1494 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The human glucocorticoid receptor DNA binding factor, which associates with the promoter region of the glucocorticoid receptor gene (hGR gene), is a repressor of glucocorticoid receptor transcription. The amino acid sequence deduced from the cDNA sequences show the presence of three sequence motifs characteristic of a zinc finger and one motif suggestive of a leucine zipper in which 1 cysteine is found instead of all leucines. The GRLF1 enhances the homologous down-regulation of wild-type hGR gene expression. Biochemical analysis suggests that GRLF1 interaction is sequence specific and that transcriptional efficacy of GRLF1 is regulated through its interaction with specific sequence motif. The level of expression is regulated by glucocorticoids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die within 2 days of birth and never survive beyond 3 weeks. Observed phenotypes include defects in eye morphogenesis, forebrain development, neural tube closure, axon guidance and fasciculation, and renal abnormalities, including hypoplastic and glomerulocystic kidneys, associated with a ciliogenesis defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,008,502 K3388E probably damaging Het
Aldh3b2 A T 19: 3,978,134 Q92L probably benign Het
BC067074 C T 13: 113,320,891 T1157I Het
Birc3 A C 9: 7,861,004 S104R probably benign Het
Bloc1s4 A G 5: 36,748,141 F169L probably benign Het
Cacna1s C T 1: 136,118,665 S1725F probably benign Het
Cadm2 A T 16: 66,812,842 S139R possibly damaging Het
Ccdc188 G T 16: 18,218,012 R17L probably benign Het
Cfap54 T C 10: 92,884,796 T2599A unknown Het
Ddx10 T C 9: 53,225,520 K364R probably damaging Het
Dlgap2 T C 8: 14,831,600 C891R probably benign Het
Dnah17 T A 11: 118,125,918 Y269F probably benign Het
Dock1 A G 7: 134,999,288 D984G possibly damaging Het
Dyrk4 T A 6: 126,891,649 T297S possibly damaging Het
Efemp2 C T 19: 5,476,218 Q124* probably null Het
Erich3 A G 3: 154,733,513 E264G probably damaging Het
Fam208a A G 14: 27,442,481 D248G possibly damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Got1l1 G T 8: 27,200,302 L114I possibly damaging Het
Gpr139 A G 7: 119,184,287 C30R probably benign Het
Gstt4 T C 10: 75,818,514 I113V probably benign Het
Hmcn2 C A 2: 31,350,070 Q458K probably benign Het
Hr G A 14: 70,567,842 S1008N possibly damaging Het
Kif14 C T 1: 136,476,352 L525F probably benign Het
Lama1 A T 17: 67,745,922 I417F Het
Limd1 A T 9: 123,500,151 K469* probably null Het
Lipo2 T C 19: 33,720,994 M328V possibly damaging Het
Lrrk1 T C 7: 66,342,782 S81G probably benign Het
Ltn1 G A 16: 87,418,497 R417W probably damaging Het
Mamdc2 T C 19: 23,334,029 D487G probably damaging Het
Mmp3 A C 9: 7,446,985 K55T probably benign Het
Mob1b A G 5: 88,753,234 I167V probably benign Het
Mocs3 A G 2: 168,231,881 N416S probably damaging Het
Mtrr A G 13: 68,577,621 F123S probably damaging Het
Muc5b A G 7: 141,865,175 T3953A possibly damaging Het
Myh7 G A 14: 54,973,319 Q1714* probably null Het
Nrf1 A G 6: 30,098,450 K114E possibly damaging Het
Olfr275 A G 4: 52,825,849 T151A probably benign Het
Olfr288 A T 15: 98,186,958 S280T probably benign Het
Olfr822 A G 10: 130,075,006 I199V probably benign Het
Prob1 T C 18: 35,653,233 D656G possibly damaging Het
Rbm24 A T 13: 46,428,968 Y121F probably benign Het
Rbm24 C T 13: 46,429,291 Q229* probably null Het
Rd3l C T 12: 111,980,052 V97I probably benign Het
Rere G A 4: 150,617,339 R25H probably damaging Het
Rgs20 T C 1: 4,912,415 M144V probably benign Het
Robo1 A G 16: 72,978,581 I665V probably benign Het
Slc18b1 T C 10: 23,822,943 L339S probably damaging Het
Slc25a17 G A 15: 81,338,047 L75F probably damaging Het
Snx29 A G 16: 11,571,716 N226D probably benign Het
Tmprss11b A G 5: 86,664,962 probably null Het
Tpp2 T C 1: 43,970,440 V478A probably damaging Het
Unc13b A G 4: 43,239,918 E746G probably benign Het
Urb2 A G 8: 124,028,040 E162G probably benign Het
Vwf C T 6: 125,570,559 Q198* probably null Het
Zhx3 T C 2: 160,781,699 M183V probably damaging Het
Other mutations in Arhgap35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Arhgap35 APN 7 16564415 missense probably benign 0.03
IGL00684:Arhgap35 APN 7 16561700 missense possibly damaging 0.93
IGL01385:Arhgap35 APN 7 16564474 missense probably damaging 0.96
IGL01411:Arhgap35 APN 7 16564267 missense probably benign
IGL01922:Arhgap35 APN 7 16564255 missense possibly damaging 0.73
IGL01977:Arhgap35 APN 7 16563203 missense probably damaging 1.00
IGL02074:Arhgap35 APN 7 16563055 missense probably benign 0.19
IGL02305:Arhgap35 APN 7 16563665 missense probably benign 0.15
IGL02342:Arhgap35 APN 7 16562380 missense probably benign 0.12
IGL02973:Arhgap35 APN 7 16562878 missense possibly damaging 0.50
IGL02989:Arhgap35 APN 7 16497655 makesense probably null
PIT4382001:Arhgap35 UTSW 7 16563869 missense possibly damaging 0.95
PIT4431001:Arhgap35 UTSW 7 16561611 missense possibly damaging 0.87
R0047:Arhgap35 UTSW 7 16561992 missense probably benign 0.17
R1690:Arhgap35 UTSW 7 16563281 missense probably damaging 1.00
R1820:Arhgap35 UTSW 7 16561949 missense possibly damaging 0.92
R2036:Arhgap35 UTSW 7 16563133 missense probably damaging 1.00
R2205:Arhgap35 UTSW 7 16498025 splice site probably null
R2292:Arhgap35 UTSW 7 16563551 missense probably damaging 1.00
R3079:Arhgap35 UTSW 7 16562576 missense probably damaging 1.00
R3745:Arhgap35 UTSW 7 16563722 missense probably damaging 1.00
R3762:Arhgap35 UTSW 7 16565075 missense probably damaging 0.98
R4661:Arhgap35 UTSW 7 16564738 missense probably damaging 1.00
R4709:Arhgap35 UTSW 7 16563586 missense probably damaging 0.97
R4749:Arhgap35 UTSW 7 16498626 missense possibly damaging 0.95
R5081:Arhgap35 UTSW 7 16565134 missense possibly damaging 0.71
R5131:Arhgap35 UTSW 7 16511187 splice site probably null
R5175:Arhgap35 UTSW 7 16562599 missense probably damaging 1.00
R5440:Arhgap35 UTSW 7 16562924 missense probably damaging 1.00
R5517:Arhgap35 UTSW 7 16563489 missense probably damaging 1.00
R5987:Arhgap35 UTSW 7 16563467 missense possibly damaging 0.84
R6087:Arhgap35 UTSW 7 16563643 missense probably damaging 1.00
R6139:Arhgap35 UTSW 7 16563467 missense possibly damaging 0.84
R6396:Arhgap35 UTSW 7 16562299 missense probably damaging 0.99
R6878:Arhgap35 UTSW 7 16565113 missense probably benign 0.00
R7063:Arhgap35 UTSW 7 16565113 missense probably benign 0.00
R7150:Arhgap35 UTSW 7 16562566 missense probably damaging 0.96
R7269:Arhgap35 UTSW 7 16561727 missense probably benign
R7276:Arhgap35 UTSW 7 16564568 missense probably damaging 1.00
R7517:Arhgap35 UTSW 7 16562207 missense probably benign 0.31
R7593:Arhgap35 UTSW 7 16564861 missense probably damaging 1.00
R7775:Arhgap35 UTSW 7 16562648 missense probably benign 0.01
R7792:Arhgap35 UTSW 7 16561528 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CCCGAAACAGGTGGTATGATGG -3'
(R):5'- CCTCCTTGGCAATGTTACGTG -3'

Sequencing Primer
(F):5'- GGAGGCTCCACATCTTCTTCTGAG -3'
(R):5'- GGCAATGTTACGTGCCTTTC -3'
Posted On2020-06-30