Incidental Mutation 'R8101:Dlgap2'
ID 630512
Institutional Source Beutler Lab
Gene Symbol Dlgap2
Ensembl Gene ENSMUSG00000047495
Gene Name DLG associated protein 2
Synonyms PSD-95/SAP90-binding protein 2, DAP2, Sapap2, 6430596N04Rik, SAP90/PSD-95-associated protein 2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8101 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 14095865-14847680 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 14831600 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 891 (C891R)
Ref Sequence ENSEMBL: ENSMUSP00000123078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043279] [ENSMUST00000133298] [ENSMUST00000150247] [ENSMUST00000152652]
AlphaFold Q8BJ42
Predicted Effect probably benign
Transcript: ENSMUST00000043279
AA Change: C890R

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000039647
Gene: ENSMUSG00000047495
AA Change: C890R

DomainStartEndE-ValueType
low complexity region 269 294 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 446 456 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
Pfam:GKAP 707 1059 1.5e-151 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133298
AA Change: C890R

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000119613
Gene: ENSMUSG00000047495
AA Change: C890R

DomainStartEndE-ValueType
low complexity region 269 294 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 446 456 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
Pfam:GKAP 707 1059 1.5e-151 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000150247
AA Change: C876R

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123104
Gene: ENSMUSG00000047495
AA Change: C876R

DomainStartEndE-ValueType
low complexity region 269 294 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 446 456 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
Pfam:GKAP 707 1045 1e-151 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152652
AA Change: C891R

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000123078
Gene: ENSMUSG00000047495
AA Change: C891R

DomainStartEndE-ValueType
low complexity region 270 295 N/A INTRINSIC
low complexity region 298 311 N/A INTRINSIC
low complexity region 447 457 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 615 629 N/A INTRINSIC
Pfam:GKAP 715 1060 1.9e-160 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a membrane-associated protein that may play a role in synapse organization and signalling in neuronal cells. This gene is biallelically expressed in the brain, however, only the paternal allele is expressed in the testis (PMID:18055845). Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,008,502 K3388E probably damaging Het
Aldh3b2 A T 19: 3,978,134 Q92L probably benign Het
Arhgap35 A T 7: 16,562,319 D940E probably benign Het
BC067074 C T 13: 113,320,891 T1157I Het
Birc3 A C 9: 7,861,004 S104R probably benign Het
Bloc1s4 A G 5: 36,748,141 F169L probably benign Het
Cacna1s C T 1: 136,118,665 S1725F probably benign Het
Cadm2 A T 16: 66,812,842 S139R possibly damaging Het
Ccdc188 G T 16: 18,218,012 R17L probably benign Het
Cfap54 T C 10: 92,884,796 T2599A unknown Het
Ddx10 T C 9: 53,225,520 K364R probably damaging Het
Dnah17 T A 11: 118,125,918 Y269F probably benign Het
Dock1 A G 7: 134,999,288 D984G possibly damaging Het
Dyrk4 T A 6: 126,891,649 T297S possibly damaging Het
Efemp2 C T 19: 5,476,218 Q124* probably null Het
Erich3 A G 3: 154,733,513 E264G probably damaging Het
Fam208a A G 14: 27,442,481 D248G possibly damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Got1l1 G T 8: 27,200,302 L114I possibly damaging Het
Gpr139 A G 7: 119,184,287 C30R probably benign Het
Gstt4 T C 10: 75,818,514 I113V probably benign Het
Hmcn2 C A 2: 31,350,070 Q458K probably benign Het
Hr G A 14: 70,567,842 S1008N possibly damaging Het
Kif14 C T 1: 136,476,352 L525F probably benign Het
Lama1 A T 17: 67,745,922 I417F Het
Limd1 A T 9: 123,500,151 K469* probably null Het
Lipo2 T C 19: 33,720,994 M328V possibly damaging Het
Lrrk1 T C 7: 66,342,782 S81G probably benign Het
Ltn1 G A 16: 87,418,497 R417W probably damaging Het
Mamdc2 T C 19: 23,334,029 D487G probably damaging Het
Mmp3 A C 9: 7,446,985 K55T probably benign Het
Mob1b A G 5: 88,753,234 I167V probably benign Het
Mocs3 A G 2: 168,231,881 N416S probably damaging Het
Mtrr A G 13: 68,577,621 F123S probably damaging Het
Muc5b A G 7: 141,865,175 T3953A possibly damaging Het
Myh7 G A 14: 54,973,319 Q1714* probably null Het
Nrf1 A G 6: 30,098,450 K114E possibly damaging Het
Olfr275 A G 4: 52,825,849 T151A probably benign Het
Olfr288 A T 15: 98,186,958 S280T probably benign Het
Olfr822 A G 10: 130,075,006 I199V probably benign Het
Prob1 T C 18: 35,653,233 D656G possibly damaging Het
Rbm24 A T 13: 46,428,968 Y121F probably benign Het
Rbm24 C T 13: 46,429,291 Q229* probably null Het
Rd3l C T 12: 111,980,052 V97I probably benign Het
Rere G A 4: 150,617,339 R25H probably damaging Het
Rgs20 T C 1: 4,912,415 M144V probably benign Het
Robo1 A G 16: 72,978,581 I665V probably benign Het
Slc18b1 T C 10: 23,822,943 L339S probably damaging Het
Slc25a17 G A 15: 81,338,047 L75F probably damaging Het
Snx29 A G 16: 11,571,716 N226D probably benign Het
Tmprss11b A G 5: 86,664,962 probably null Het
Tpp2 T C 1: 43,970,440 V478A probably damaging Het
Unc13b A G 4: 43,239,918 E746G probably benign Het
Urb2 A G 8: 124,028,040 E162G probably benign Het
Vwf C T 6: 125,570,559 Q198* probably null Het
Zhx3 T C 2: 160,781,699 M183V probably damaging Het
Other mutations in Dlgap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01476:Dlgap2 APN 8 14778301 nonsense probably null
IGL01788:Dlgap2 APN 8 14843631 missense probably benign 0.19
IGL02054:Dlgap2 APN 8 14843552 missense probably damaging 0.98
IGL02969:Dlgap2 APN 8 14831579 missense possibly damaging 0.95
IGL03183:Dlgap2 APN 8 14727525 missense possibly damaging 0.62
IGL03303:Dlgap2 APN 8 14727812 missense probably damaging 0.99
G1Funyon:Dlgap2 UTSW 8 14823577 missense probably benign 0.27
PIT4403001:Dlgap2 UTSW 8 14831528 missense probably damaging 1.00
R0026:Dlgap2 UTSW 8 14727363 nonsense probably null
R0242:Dlgap2 UTSW 8 14727562 missense probably benign 0.34
R0242:Dlgap2 UTSW 8 14727562 missense probably benign 0.34
R0647:Dlgap2 UTSW 8 14727591 missense possibly damaging 0.95
R1221:Dlgap2 UTSW 8 14726952 missense probably benign 0.08
R1374:Dlgap2 UTSW 8 14831228 splice site probably benign
R1440:Dlgap2 UTSW 8 14727060 missense probably benign
R1544:Dlgap2 UTSW 8 14829861 splice site probably null
R1550:Dlgap2 UTSW 8 14822499 missense probably damaging 0.98
R1804:Dlgap2 UTSW 8 14727809 missense possibly damaging 0.71
R1870:Dlgap2 UTSW 8 14773347 missense probably damaging 1.00
R1921:Dlgap2 UTSW 8 14843624 missense probably benign 0.10
R2119:Dlgap2 UTSW 8 14778206 missense possibly damaging 0.69
R2193:Dlgap2 UTSW 8 14743431 missense possibly damaging 0.51
R4381:Dlgap2 UTSW 8 14846502 missense probably benign
R4422:Dlgap2 UTSW 8 14743463 critical splice donor site probably null
R4521:Dlgap2 UTSW 8 14727871 missense probably damaging 1.00
R4581:Dlgap2 UTSW 8 14846679 missense probably damaging 1.00
R4585:Dlgap2 UTSW 8 14727999 critical splice donor site probably null
R4760:Dlgap2 UTSW 8 14773380 missense probably damaging 1.00
R5077:Dlgap2 UTSW 8 14822691 missense probably benign 0.35
R5373:Dlgap2 UTSW 8 14823614 missense probably benign 0.19
R5374:Dlgap2 UTSW 8 14823614 missense probably benign 0.19
R5552:Dlgap2 UTSW 8 14831342 nonsense probably null
R5964:Dlgap2 UTSW 8 14727128 nonsense probably null
R6125:Dlgap2 UTSW 8 14727193 missense possibly damaging 0.78
R6147:Dlgap2 UTSW 8 14727294 missense probably benign 0.05
R6163:Dlgap2 UTSW 8 14846641 missense probably damaging 1.00
R6269:Dlgap2 UTSW 8 14822369 missense probably benign 0.01
R6629:Dlgap2 UTSW 8 14831465 missense probably benign 0.00
R6765:Dlgap2 UTSW 8 14743284 missense probably benign 0.00
R6809:Dlgap2 UTSW 8 14179619 intron probably benign
R6913:Dlgap2 UTSW 8 14778374 missense probably benign 0.10
R7219:Dlgap2 UTSW 8 14743296 missense probably benign 0.00
R7485:Dlgap2 UTSW 8 14829952 missense probably damaging 0.97
R7560:Dlgap2 UTSW 8 14822697 critical splice donor site probably null
R7826:Dlgap2 UTSW 8 14743410 missense probably benign 0.38
R7976:Dlgap2 UTSW 8 14743410 missense probably benign 0.38
R8301:Dlgap2 UTSW 8 14823577 missense probably benign 0.27
R8333:Dlgap2 UTSW 8 14778295 missense probably benign 0.03
R8367:Dlgap2 UTSW 8 14843544 missense probably benign 0.00
R8492:Dlgap2 UTSW 8 14778271 missense possibly damaging 0.49
R8685:Dlgap2 UTSW 8 14831628 missense possibly damaging 0.71
R8690:Dlgap2 UTSW 8 14743430 missense probably benign 0.00
R8887:Dlgap2 UTSW 8 14179682 critical splice donor site probably null
R9328:Dlgap2 UTSW 8 14727441 missense probably damaging 1.00
R9338:Dlgap2 UTSW 8 14179683 critical splice donor site probably null
R9465:Dlgap2 UTSW 8 14778226 missense probably damaging 1.00
R9680:Dlgap2 UTSW 8 14846653 missense probably damaging 0.98
X0060:Dlgap2 UTSW 8 14839787 missense probably damaging 1.00
Z1088:Dlgap2 UTSW 8 14822472 missense probably benign 0.10
Z1177:Dlgap2 UTSW 8 14727659 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCAGGCTGACTTAGAGC -3'
(R):5'- ACACTGCTTCTTGGGATGGAG -3'

Sequencing Primer
(F):5'- CCTCTTCAGTTACAGGGAGGACTAC -3'
(R):5'- CTTGGGATGGAGTGGGGGAC -3'
Posted On 2020-06-30