Incidental Mutation 'R8101:Birc3'
ID630516
Institutional Source Beutler Lab
Gene Symbol Birc3
Ensembl Gene ENSMUSG00000032000
Gene Namebaculoviral IAP repeat-containing 3
SynonymsApi2, cIAP2, cIAP-2, HIAP2, IAP2, MIAP2, MIHC, RNF49
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.670) question?
Stock #R8101 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location7848699-7873186 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 7861004 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 104 (S104R)
Ref Sequence ENSEMBL: ENSMUSP00000013949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013949] [ENSMUST00000115672] [ENSMUST00000115673] [ENSMUST00000159323]
Predicted Effect probably benign
Transcript: ENSMUST00000013949
AA Change: S104R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000013949
Gene: ENSMUSG00000032000
AA Change: S104R

DomainStartEndE-ValueType
BIR 27 98 1.92e-34 SMART
low complexity region 132 145 N/A INTRINSIC
BIR 167 237 2.12e-36 SMART
BIR 253 324 1.5e-36 SMART
CARD 438 525 7.29e-4 SMART
RING 555 589 1.43e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115672
AA Change: S104R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000111336
Gene: ENSMUSG00000032000
AA Change: S104R

DomainStartEndE-ValueType
BIR 27 98 1.92e-34 SMART
low complexity region 132 145 N/A INTRINSIC
BIR 167 237 2.12e-36 SMART
BIR 253 324 1.5e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115673
AA Change: S104R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000111337
Gene: ENSMUSG00000032000
AA Change: S104R

DomainStartEndE-ValueType
BIR 27 98 1.92e-34 SMART
low complexity region 132 145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159323
AA Change: S104R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000125652
Gene: ENSMUSG00000032000
AA Change: S104R

DomainStartEndE-ValueType
BIR 27 98 1.92e-34 SMART
low complexity region 132 145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161642
SMART Domains Protein: ENSMUSP00000125512
Gene: ENSMUSG00000032000

DomainStartEndE-ValueType
SCOP:d1g73d_ 4 35 1e-6 SMART
PDB:3T6P|A 4 106 2e-39 PDB
low complexity region 107 125 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IAP family of proteins that inhibit apoptosis by binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2, probably by interfering with activation of ICE-like proteases. The encoded protein inhibits apoptosis induced by serum deprivation but does not affect apoptosis resulting from exposure to menadione, a potent inducer of free radicals. It contains 3 baculovirus IAP repeats and a ring finger domain. Transcript variants encoding the same isoform have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene have a reduced susceptibility to endotoxic shock. Mice homozygous for a knock-in allele exhibit increased B cell survival and proliferation, lymph node hyperplasia, lymphocytic infiltrates in the lungs, and enlarged gut-associated lympoid tissue. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,008,502 K3388E probably damaging Het
Aldh3b2 A T 19: 3,978,134 Q92L probably benign Het
Arhgap35 A T 7: 16,562,319 D940E probably benign Het
BC067074 C T 13: 113,320,891 T1157I Het
Bloc1s4 A G 5: 36,748,141 F169L probably benign Het
Cacna1s C T 1: 136,118,665 S1725F probably benign Het
Cadm2 A T 16: 66,812,842 S139R possibly damaging Het
Ccdc188 G T 16: 18,218,012 R17L probably benign Het
Cfap54 T C 10: 92,884,796 T2599A unknown Het
Ddx10 T C 9: 53,225,520 K364R probably damaging Het
Dlgap2 T C 8: 14,831,600 C891R probably benign Het
Dnah17 T A 11: 118,125,918 Y269F probably benign Het
Dock1 A G 7: 134,999,288 D984G possibly damaging Het
Dyrk4 T A 6: 126,891,649 T297S possibly damaging Het
Efemp2 C T 19: 5,476,218 Q124* probably null Het
Erich3 A G 3: 154,733,513 E264G probably damaging Het
Fam208a A G 14: 27,442,481 D248G possibly damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Got1l1 G T 8: 27,200,302 L114I possibly damaging Het
Gpr139 A G 7: 119,184,287 C30R probably benign Het
Gstt4 T C 10: 75,818,514 I113V probably benign Het
Hmcn2 C A 2: 31,350,070 Q458K probably benign Het
Hr G A 14: 70,567,842 S1008N possibly damaging Het
Kif14 C T 1: 136,476,352 L525F probably benign Het
Lama1 A T 17: 67,745,922 I417F Het
Limd1 A T 9: 123,500,151 K469* probably null Het
Lipo2 T C 19: 33,720,994 M328V possibly damaging Het
Lrrk1 T C 7: 66,342,782 S81G probably benign Het
Ltn1 G A 16: 87,418,497 R417W probably damaging Het
Mamdc2 T C 19: 23,334,029 D487G probably damaging Het
Mmp3 A C 9: 7,446,985 K55T probably benign Het
Mob1b A G 5: 88,753,234 I167V probably benign Het
Mocs3 A G 2: 168,231,881 N416S probably damaging Het
Mtrr A G 13: 68,577,621 F123S probably damaging Het
Muc5b A G 7: 141,865,175 T3953A possibly damaging Het
Myh7 G A 14: 54,973,319 Q1714* probably null Het
Nrf1 A G 6: 30,098,450 K114E possibly damaging Het
Olfr275 A G 4: 52,825,849 T151A probably benign Het
Olfr288 A T 15: 98,186,958 S280T probably benign Het
Olfr822 A G 10: 130,075,006 I199V probably benign Het
Prob1 T C 18: 35,653,233 D656G possibly damaging Het
Rbm24 A T 13: 46,428,968 Y121F probably benign Het
Rbm24 C T 13: 46,429,291 Q229* probably null Het
Rd3l C T 12: 111,980,052 V97I probably benign Het
Rere G A 4: 150,617,339 R25H probably damaging Het
Rgs20 T C 1: 4,912,415 M144V probably benign Het
Robo1 A G 16: 72,978,581 I665V probably benign Het
Slc18b1 T C 10: 23,822,943 L339S probably damaging Het
Slc25a17 G A 15: 81,338,047 L75F probably damaging Het
Snx29 A G 16: 11,571,716 N226D probably benign Het
Tmprss11b A G 5: 86,664,962 probably null Het
Tpp2 T C 1: 43,970,440 V478A probably damaging Het
Unc13b A G 4: 43,239,918 E746G probably benign Het
Urb2 A G 8: 124,028,040 E162G probably benign Het
Vwf C T 6: 125,570,559 Q198* probably null Het
Zhx3 T C 2: 160,781,699 M183V probably damaging Het
Other mutations in Birc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Birc3 APN 9 7860732 missense probably damaging 1.00
IGL02852:Birc3 APN 9 7854483 missense probably damaging 0.99
IGL03135:Birc3 APN 9 7849721 splice site probably benign
R0478:Birc3 UTSW 9 7860347 missense probably damaging 1.00
R0905:Birc3 UTSW 9 7851051 makesense probably null
R1934:Birc3 UTSW 9 7854499 missense possibly damaging 0.89
R2005:Birc3 UTSW 9 7860341 missense probably damaging 1.00
R3019:Birc3 UTSW 9 7857389 critical splice donor site probably null
R4169:Birc3 UTSW 9 7849683 missense possibly damaging 0.78
R4964:Birc3 UTSW 9 7860552 missense probably benign 0.01
R5338:Birc3 UTSW 9 7857359 missense probably benign 0.01
R5395:Birc3 UTSW 9 7861174 missense probably damaging 1.00
R5877:Birc3 UTSW 9 7849346 missense probably damaging 1.00
R5914:Birc3 UTSW 9 7857342 makesense probably null
R6148:Birc3 UTSW 9 7849683 missense possibly damaging 0.78
R6471:Birc3 UTSW 9 7857420 missense probably benign 0.00
R6747:Birc3 UTSW 9 7860261 critical splice donor site probably null
R6752:Birc3 UTSW 9 7857344 missense probably benign 0.10
R6812:Birc3 UTSW 9 7854417 missense probably damaging 0.99
R8078:Birc3 UTSW 9 7858741 missense probably damaging 0.98
R8314:Birc3 UTSW 9 7872941 intron probably benign
R8371:Birc3 UTSW 9 7849426 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGACTTGTGCTCAAAGC -3'
(R):5'- TGTGAGCTGTACCGATTGTC -3'

Sequencing Primer
(F):5'- CAGGACAATCTTGATTTGCTCGGAAG -3'
(R):5'- AGTTCCTGTGTCAGAAAGGAGTC -3'
Posted On2020-06-30