Incidental Mutation 'R8101:Slc18b1'
ID630519
Institutional Source Beutler Lab
Gene Symbol Slc18b1
Ensembl Gene ENSMUSG00000037455
Gene Namesolute carrier family 18, subfamily B, member 1
Synonyms1110021L09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R8101 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location23796986-23827968 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23822943 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 339 (L339S)
Ref Sequence ENSEMBL: ENSMUSP00000137431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119597] [ENSMUST00000179321]
Predicted Effect probably damaging
Transcript: ENSMUST00000119597
AA Change: L337S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112634
Gene: ENSMUSG00000037455
AA Change: L337S

DomainStartEndE-ValueType
low complexity region 4 32 N/A INTRINSIC
Pfam:MFS_1 40 254 3.2e-26 PFAM
Pfam:MFS_1 237 454 7.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127841
Predicted Effect probably damaging
Transcript: ENSMUST00000179321
AA Change: L339S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137431
Gene: ENSMUSG00000037455
AA Change: L339S

DomainStartEndE-ValueType
low complexity region 4 32 N/A INTRINSIC
Pfam:MFS_1 40 262 2.4e-26 PFAM
Pfam:LacY_symp 226 454 3.9e-8 PFAM
Pfam:MFS_1 241 456 4.9e-23 PFAM
Pfam:MFS_2 253 458 3.7e-9 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein, which has high sequence similarity to rat, xenopus and zebrafish proteins. The protein function is unknown. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,008,502 K3388E probably damaging Het
Aldh3b2 A T 19: 3,978,134 Q92L probably benign Het
Arhgap35 A T 7: 16,562,319 D940E probably benign Het
BC067074 C T 13: 113,320,891 T1157I Het
Birc3 A C 9: 7,861,004 S104R probably benign Het
Bloc1s4 A G 5: 36,748,141 F169L probably benign Het
Cacna1s C T 1: 136,118,665 S1725F probably benign Het
Cadm2 A T 16: 66,812,842 S139R possibly damaging Het
Ccdc188 G T 16: 18,218,012 R17L probably benign Het
Cfap54 T C 10: 92,884,796 T2599A unknown Het
Ddx10 T C 9: 53,225,520 K364R probably damaging Het
Dlgap2 T C 8: 14,831,600 C891R probably benign Het
Dnah17 T A 11: 118,125,918 Y269F probably benign Het
Dock1 A G 7: 134,999,288 D984G possibly damaging Het
Dyrk4 T A 6: 126,891,649 T297S possibly damaging Het
Efemp2 C T 19: 5,476,218 Q124* probably null Het
Erich3 A G 3: 154,733,513 E264G probably damaging Het
Fam208a A G 14: 27,442,481 D248G possibly damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Got1l1 G T 8: 27,200,302 L114I possibly damaging Het
Gpr139 A G 7: 119,184,287 C30R probably benign Het
Gstt4 T C 10: 75,818,514 I113V probably benign Het
Hmcn2 C A 2: 31,350,070 Q458K probably benign Het
Hr G A 14: 70,567,842 S1008N possibly damaging Het
Kif14 C T 1: 136,476,352 L525F probably benign Het
Lama1 A T 17: 67,745,922 I417F Het
Limd1 A T 9: 123,500,151 K469* probably null Het
Lipo2 T C 19: 33,720,994 M328V possibly damaging Het
Lrrk1 T C 7: 66,342,782 S81G probably benign Het
Ltn1 G A 16: 87,418,497 R417W probably damaging Het
Mamdc2 T C 19: 23,334,029 D487G probably damaging Het
Mmp3 A C 9: 7,446,985 K55T probably benign Het
Mob1b A G 5: 88,753,234 I167V probably benign Het
Mocs3 A G 2: 168,231,881 N416S probably damaging Het
Mtrr A G 13: 68,577,621 F123S probably damaging Het
Muc5b A G 7: 141,865,175 T3953A possibly damaging Het
Myh7 G A 14: 54,973,319 Q1714* probably null Het
Nrf1 A G 6: 30,098,450 K114E possibly damaging Het
Olfr275 A G 4: 52,825,849 T151A probably benign Het
Olfr288 A T 15: 98,186,958 S280T probably benign Het
Olfr822 A G 10: 130,075,006 I199V probably benign Het
Prob1 T C 18: 35,653,233 D656G possibly damaging Het
Rbm24 A T 13: 46,428,968 Y121F probably benign Het
Rbm24 C T 13: 46,429,291 Q229* probably null Het
Rd3l C T 12: 111,980,052 V97I probably benign Het
Rere G A 4: 150,617,339 R25H probably damaging Het
Rgs20 T C 1: 4,912,415 M144V probably benign Het
Robo1 A G 16: 72,978,581 I665V probably benign Het
Slc25a17 G A 15: 81,338,047 L75F probably damaging Het
Snx29 A G 16: 11,571,716 N226D probably benign Het
Tmprss11b A G 5: 86,664,962 probably null Het
Tpp2 T C 1: 43,970,440 V478A probably damaging Het
Unc13b A G 4: 43,239,918 E746G probably benign Het
Urb2 A G 8: 124,028,040 E162G probably benign Het
Vwf C T 6: 125,570,559 Q198* probably null Het
Zhx3 T C 2: 160,781,699 M183V probably damaging Het
Other mutations in Slc18b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Slc18b1 APN 10 23824761 critical splice donor site probably null
IGL01474:Slc18b1 APN 10 23803850 missense probably benign 0.35
IGL01788:Slc18b1 APN 10 23826001 missense probably damaging 0.96
IGL02660:Slc18b1 APN 10 23810952 splice site probably benign
IGL03049:Slc18b1 APN 10 23822946 missense probably benign 0.01
IGL03106:Slc18b1 APN 10 23826659 makesense probably null
R0440:Slc18b1 UTSW 10 23819078 missense probably benign 0.16
R0633:Slc18b1 UTSW 10 23806038 missense probably benign 0.00
R1086:Slc18b1 UTSW 10 23803795 missense probably benign 0.02
R1572:Slc18b1 UTSW 10 23798741 splice site probably benign
R1842:Slc18b1 UTSW 10 23805993 missense possibly damaging 0.87
R2256:Slc18b1 UTSW 10 23810922 missense probably benign 0.25
R3423:Slc18b1 UTSW 10 23822976 missense probably damaging 0.99
R3424:Slc18b1 UTSW 10 23822976 missense probably damaging 0.99
R3425:Slc18b1 UTSW 10 23822976 missense probably damaging 0.99
R3765:Slc18b1 UTSW 10 23798749 missense probably damaging 0.99
R3766:Slc18b1 UTSW 10 23798749 missense probably damaging 0.99
R4063:Slc18b1 UTSW 10 23805981 missense probably benign 0.01
R4779:Slc18b1 UTSW 10 23820869 missense possibly damaging 0.71
R5714:Slc18b1 UTSW 10 23798766 missense probably benign 0.00
R5910:Slc18b1 UTSW 10 23824667 intron probably benign
R6084:Slc18b1 UTSW 10 23804212 missense probably benign 0.15
R6789:Slc18b1 UTSW 10 23816329 missense probably benign 0.02
R6868:Slc18b1 UTSW 10 23804234 missense possibly damaging 0.95
R6959:Slc18b1 UTSW 10 23826044 splice site probably null
R7632:Slc18b1 UTSW 10 23826182 missense probably benign
R8838:Slc18b1 UTSW 10 23820866 missense probably benign 0.25
R8868:Slc18b1 UTSW 10 23810853 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCATTTGTGCAGCTGATTCTG -3'
(R):5'- TTGGGCAAACATCCTATGGG -3'

Sequencing Primer
(F):5'- CAGATTTCTGAGTTCGAGACCAGC -3'
(R):5'- ATCCTATGGGACTAAACAGCTG -3'
Posted On2020-06-30