Incidental Mutation 'R8101:Cadm2'
ID 630536
Institutional Source Beutler Lab
Gene Symbol Cadm2
Ensembl Gene ENSMUSG00000064115
Gene Name cell adhesion molecule 2
Synonyms A830029E02Rik, Necl3, 2900078E11Rik, Igsf4d, SynCAM2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.476) question?
Stock # R8101 (G1)
Quality Score 211.009
Status Not validated
Chromosome 16
Chromosomal Location 66655421-67620908 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 66812842 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 139 (S139R)
Ref Sequence ENSEMBL: ENSMUSP00000109931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114292] [ENSMUST00000120594] [ENSMUST00000120898] [ENSMUST00000123266] [ENSMUST00000128168]
AlphaFold Q8BLQ9
PDB Structure Crystal structure of Ig1 domain of mouse SynCAM 2 [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000114292
AA Change: S139R

PolyPhen 2 Score 0.749 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000109931
Gene: ENSMUSG00000064115
AA Change: S139R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 38 130 2.19e-9 SMART
Pfam:Ig_3 135 216 1.2e-6 PFAM
Pfam:C2-set_2 135 222 6.4e-17 PFAM
Pfam:Ig_2 135 228 1.8e-6 PFAM
Pfam:I-set 136 229 1.3e-7 PFAM
Pfam:C1-set 142 225 1.5e-9 PFAM
IGc2 248 312 2.56e-10 SMART
4.1m 357 375 5.39e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000120594
AA Change: S130R

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113500
Gene: ENSMUSG00000064115
AA Change: S130R

DomainStartEndE-ValueType
IG 29 121 2.19e-9 SMART
Pfam:Ig_3 126 207 4.2e-7 PFAM
Pfam:C2-set_2 126 213 1.8e-16 PFAM
Pfam:I-set 127 220 1.5e-7 PFAM
Pfam:C1-set 133 216 7e-10 PFAM
Pfam:ig 133 218 9.5e-9 PFAM
IGc2 239 303 2.56e-10 SMART
low complexity region 319 352 N/A INTRINSIC
4.1m 388 406 5.39e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000120898
AA Change: S130R

PolyPhen 2 Score 0.749 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113178
Gene: ENSMUSG00000064115
AA Change: S130R

DomainStartEndE-ValueType
IG 29 121 2.19e-9 SMART
Pfam:Ig_3 126 207 1.2e-6 PFAM
Pfam:C2-set_2 126 213 6.2e-17 PFAM
Pfam:Ig_2 126 219 1.7e-6 PFAM
Pfam:I-set 127 220 1.3e-7 PFAM
Pfam:C1-set 133 216 1.5e-9 PFAM
IGc2 239 303 2.56e-10 SMART
4.1m 348 366 5.39e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123266
SMART Domains Protein: ENSMUSP00000123192
Gene: ENSMUSG00000064115

DomainStartEndE-ValueType
Blast:IG_like 19 53 1e-15 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000128168
AA Change: S130R

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000134554
Gene: ENSMUSG00000064115
AA Change: S130R

DomainStartEndE-ValueType
IG 29 121 2.19e-9 SMART
Pfam:Ig_3 126 207 1.4e-6 PFAM
Pfam:C2-set_2 126 213 7.2e-16 PFAM
Pfam:I-set 127 220 5e-7 PFAM
Pfam:C1-set 133 216 2.2e-9 PFAM
Pfam:ig 133 218 3.6e-8 PFAM
IGc2 239 303 2.56e-10 SMART
low complexity region 319 352 N/A INTRINSIC
4.1m 388 406 5.39e-5 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the synaptic cell adhesion molecule 1 (SynCAM) family which belongs to the immunoglobulin (Ig) superfamily. The encoded protein has three Ig-like domains and a cytosolic protein 4.1 binding site near the C-terminus. Proteins belonging to the protein 4.1 family crosslink spectrin and interact with other cytoskeletal proteins. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice with ubiquitous conditional deletion of the gene do not display any neurological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,008,502 K3388E probably damaging Het
Aldh3b2 A T 19: 3,978,134 Q92L probably benign Het
Arhgap35 A T 7: 16,562,319 D940E probably benign Het
BC067074 C T 13: 113,320,891 T1157I Het
Birc3 A C 9: 7,861,004 S104R probably benign Het
Bloc1s4 A G 5: 36,748,141 F169L probably benign Het
Cacna1s C T 1: 136,118,665 S1725F probably benign Het
Ccdc188 G T 16: 18,218,012 R17L probably benign Het
Cfap54 T C 10: 92,884,796 T2599A unknown Het
Ddx10 T C 9: 53,225,520 K364R probably damaging Het
Dlgap2 T C 8: 14,831,600 C891R probably benign Het
Dnah17 T A 11: 118,125,918 Y269F probably benign Het
Dock1 A G 7: 134,999,288 D984G possibly damaging Het
Dyrk4 T A 6: 126,891,649 T297S possibly damaging Het
Efemp2 C T 19: 5,476,218 Q124* probably null Het
Erich3 A G 3: 154,733,513 E264G probably damaging Het
Fam208a A G 14: 27,442,481 D248G possibly damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Got1l1 G T 8: 27,200,302 L114I possibly damaging Het
Gpr139 A G 7: 119,184,287 C30R probably benign Het
Gstt4 T C 10: 75,818,514 I113V probably benign Het
Hmcn2 C A 2: 31,350,070 Q458K probably benign Het
Hr G A 14: 70,567,842 S1008N possibly damaging Het
Kif14 C T 1: 136,476,352 L525F probably benign Het
Lama1 A T 17: 67,745,922 I417F Het
Limd1 A T 9: 123,500,151 K469* probably null Het
Lipo2 T C 19: 33,720,994 M328V possibly damaging Het
Lrrk1 T C 7: 66,342,782 S81G probably benign Het
Ltn1 G A 16: 87,418,497 R417W probably damaging Het
Mamdc2 T C 19: 23,334,029 D487G probably damaging Het
Mmp3 A C 9: 7,446,985 K55T probably benign Het
Mob1b A G 5: 88,753,234 I167V probably benign Het
Mocs3 A G 2: 168,231,881 N416S probably damaging Het
Mtrr A G 13: 68,577,621 F123S probably damaging Het
Muc5b A G 7: 141,865,175 T3953A possibly damaging Het
Myh7 G A 14: 54,973,319 Q1714* probably null Het
Nrf1 A G 6: 30,098,450 K114E possibly damaging Het
Olfr275 A G 4: 52,825,849 T151A probably benign Het
Olfr288 A T 15: 98,186,958 S280T probably benign Het
Olfr822 A G 10: 130,075,006 I199V probably benign Het
Prob1 T C 18: 35,653,233 D656G possibly damaging Het
Rbm24 A T 13: 46,428,968 Y121F probably benign Het
Rbm24 C T 13: 46,429,291 Q229* probably null Het
Rd3l C T 12: 111,980,052 V97I probably benign Het
Rere G A 4: 150,617,339 R25H probably damaging Het
Rgs20 T C 1: 4,912,415 M144V probably benign Het
Robo1 A G 16: 72,978,581 I665V probably benign Het
Slc18b1 T C 10: 23,822,943 L339S probably damaging Het
Slc25a17 G A 15: 81,338,047 L75F probably damaging Het
Snx29 A G 16: 11,571,716 N226D probably benign Het
Tmprss11b A G 5: 86,664,962 probably null Het
Tpp2 T C 1: 43,970,440 V478A probably damaging Het
Unc13b A G 4: 43,239,918 E746G probably benign Het
Urb2 A G 8: 124,028,040 E162G probably benign Het
Vwf C T 6: 125,570,559 Q198* probably null Het
Zhx3 T C 2: 160,781,699 M183V probably damaging Het
Other mutations in Cadm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Cadm2 APN 16 66882751 missense probably damaging 1.00
IGL01137:Cadm2 APN 16 66815350 missense probably damaging 1.00
IGL01340:Cadm2 APN 16 66784785 missense possibly damaging 0.62
IGL01406:Cadm2 APN 16 66815304 splice site probably null
IGL02029:Cadm2 APN 16 66747296 missense probably damaging 1.00
IGL02541:Cadm2 APN 16 66882882 missense possibly damaging 0.73
IGL02541:Cadm2 APN 16 66882883 critical splice acceptor site probably null
IGL02952:Cadm2 APN 16 66664452 missense probably damaging 0.99
vitro UTSW 16 66882832 nonsense probably null
R0050:Cadm2 UTSW 16 66953266 splice site probably benign
R0050:Cadm2 UTSW 16 66953266 splice site probably benign
R0399:Cadm2 UTSW 16 66747339 nonsense probably null
R0883:Cadm2 UTSW 16 66882814 missense probably damaging 1.00
R1035:Cadm2 UTSW 16 66815347 missense probably damaging 1.00
R1539:Cadm2 UTSW 16 66784840 missense probably damaging 1.00
R1889:Cadm2 UTSW 16 66882795 missense probably damaging 1.00
R1898:Cadm2 UTSW 16 66815383 missense probably damaging 1.00
R1918:Cadm2 UTSW 16 66747384 splice site probably benign
R2108:Cadm2 UTSW 16 66731471 missense probably benign 0.43
R2570:Cadm2 UTSW 16 66815383 missense probably damaging 1.00
R3878:Cadm2 UTSW 16 66815441 missense probably damaging 1.00
R4093:Cadm2 UTSW 16 66784788 missense possibly damaging 0.94
R4094:Cadm2 UTSW 16 66882797 missense probably damaging 1.00
R5421:Cadm2 UTSW 16 66771627 nonsense probably null
R5555:Cadm2 UTSW 16 66784815 missense probably damaging 1.00
R6173:Cadm2 UTSW 16 66882841 missense probably benign 0.04
R6188:Cadm2 UTSW 16 66815307 critical splice donor site probably null
R6224:Cadm2 UTSW 16 66664395 missense probably damaging 1.00
R6492:Cadm2 UTSW 16 66784828 missense probably damaging 0.98
R6957:Cadm2 UTSW 16 66812838 missense probably benign 0.02
R7051:Cadm2 UTSW 16 66882879 missense possibly damaging 0.86
R7183:Cadm2 UTSW 16 66882832 nonsense probably null
R7322:Cadm2 UTSW 16 66882846 missense probably damaging 1.00
R7792:Cadm2 UTSW 16 66771637 missense probably benign 0.01
R7882:Cadm2 UTSW 16 66731471 missense probably benign 0.43
R8166:Cadm2 UTSW 16 66953309 missense probably benign 0.01
R8325:Cadm2 UTSW 16 66815450 missense possibly damaging 0.95
R8496:Cadm2 UTSW 16 66664423 missense probably damaging 1.00
R8746:Cadm2 UTSW 16 66784809 missense probably damaging 0.99
R9396:Cadm2 UTSW 16 66747216 missense probably damaging 0.99
X0026:Cadm2 UTSW 16 66663152 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGCTGTGGTCTGAAACATAGAG -3'
(R):5'- CTAGATTGCCACACTGGTAAATC -3'

Sequencing Primer
(F):5'- GAGTAAATTCTCTGTTTTTCACCCAG -3'
(R):5'- TCACTGGAGAGTGACACT -3'
Posted On 2020-06-30