Incidental Mutation 'R8101:Aldh3b2'
ID 630541
Institutional Source Beutler Lab
Gene Symbol Aldh3b2
Ensembl Gene ENSMUSG00000075296
Gene Name aldehyde dehydrogenase 3 family, member B2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock # R8101 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 3972328-3981645 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 3978134 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 92 (Q92L)
Ref Sequence ENSEMBL: ENSMUSP00000115356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000143380]
AlphaFold E9Q3E1
Predicted Effect probably benign
Transcript: ENSMUST00000143380
AA Change: Q92L

PolyPhen 2 Score 0.331 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000115356
Gene: ENSMUSG00000075296
AA Change: Q92L

DomainStartEndE-ValueType
Pfam:Aldedh 6 441 1.2e-87 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,008,502 K3388E probably damaging Het
Arhgap35 A T 7: 16,562,319 D940E probably benign Het
BC067074 C T 13: 113,320,891 T1157I Het
Birc3 A C 9: 7,861,004 S104R probably benign Het
Bloc1s4 A G 5: 36,748,141 F169L probably benign Het
Cacna1s C T 1: 136,118,665 S1725F probably benign Het
Cadm2 A T 16: 66,812,842 S139R possibly damaging Het
Ccdc188 G T 16: 18,218,012 R17L probably benign Het
Cfap54 T C 10: 92,884,796 T2599A unknown Het
Ddx10 T C 9: 53,225,520 K364R probably damaging Het
Dlgap2 T C 8: 14,831,600 C891R probably benign Het
Dnah17 T A 11: 118,125,918 Y269F probably benign Het
Dock1 A G 7: 134,999,288 D984G possibly damaging Het
Dyrk4 T A 6: 126,891,649 T297S possibly damaging Het
Efemp2 C T 19: 5,476,218 Q124* probably null Het
Erich3 A G 3: 154,733,513 E264G probably damaging Het
Fam208a A G 14: 27,442,481 D248G possibly damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Got1l1 G T 8: 27,200,302 L114I possibly damaging Het
Gpr139 A G 7: 119,184,287 C30R probably benign Het
Gstt4 T C 10: 75,818,514 I113V probably benign Het
Hmcn2 C A 2: 31,350,070 Q458K probably benign Het
Hr G A 14: 70,567,842 S1008N possibly damaging Het
Kif14 C T 1: 136,476,352 L525F probably benign Het
Lama1 A T 17: 67,745,922 I417F Het
Limd1 A T 9: 123,500,151 K469* probably null Het
Lipo2 T C 19: 33,720,994 M328V possibly damaging Het
Lrrk1 T C 7: 66,342,782 S81G probably benign Het
Ltn1 G A 16: 87,418,497 R417W probably damaging Het
Mamdc2 T C 19: 23,334,029 D487G probably damaging Het
Mmp3 A C 9: 7,446,985 K55T probably benign Het
Mob1b A G 5: 88,753,234 I167V probably benign Het
Mocs3 A G 2: 168,231,881 N416S probably damaging Het
Mtrr A G 13: 68,577,621 F123S probably damaging Het
Muc5b A G 7: 141,865,175 T3953A possibly damaging Het
Myh7 G A 14: 54,973,319 Q1714* probably null Het
Nrf1 A G 6: 30,098,450 K114E possibly damaging Het
Olfr275 A G 4: 52,825,849 T151A probably benign Het
Olfr288 A T 15: 98,186,958 S280T probably benign Het
Olfr822 A G 10: 130,075,006 I199V probably benign Het
Prob1 T C 18: 35,653,233 D656G possibly damaging Het
Rbm24 A T 13: 46,428,968 Y121F probably benign Het
Rbm24 C T 13: 46,429,291 Q229* probably null Het
Rd3l C T 12: 111,980,052 V97I probably benign Het
Rere G A 4: 150,617,339 R25H probably damaging Het
Rgs20 T C 1: 4,912,415 M144V probably benign Het
Robo1 A G 16: 72,978,581 I665V probably benign Het
Slc18b1 T C 10: 23,822,943 L339S probably damaging Het
Slc25a17 G A 15: 81,338,047 L75F probably damaging Het
Snx29 A G 16: 11,571,716 N226D probably benign Het
Tmprss11b A G 5: 86,664,962 probably null Het
Tpp2 T C 1: 43,970,440 V478A probably damaging Het
Unc13b A G 4: 43,239,918 E746G probably benign Het
Urb2 A G 8: 124,028,040 E162G probably benign Het
Vwf C T 6: 125,570,559 Q198* probably null Het
Zhx3 T C 2: 160,781,699 M183V probably damaging Het
Other mutations in Aldh3b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02888:Aldh3b2 APN 19 3980083 missense probably benign 0.32
R0242:Aldh3b2 UTSW 19 3979414 nonsense probably null
R0242:Aldh3b2 UTSW 19 3979414 nonsense probably null
R0742:Aldh3b2 UTSW 19 3981034 missense probably damaging 1.00
R0924:Aldh3b2 UTSW 19 3979350 missense probably benign 0.09
R1531:Aldh3b2 UTSW 19 3977543 missense probably damaging 1.00
R1748:Aldh3b2 UTSW 19 3977572 missense probably damaging 0.99
R1899:Aldh3b2 UTSW 19 3978662 missense possibly damaging 0.55
R1968:Aldh3b2 UTSW 19 3980705 missense probably benign 0.22
R2228:Aldh3b2 UTSW 19 3981133 missense probably benign 0.00
R4282:Aldh3b2 UTSW 19 3977636 missense probably benign 0.03
R4403:Aldh3b2 UTSW 19 3980059 missense probably damaging 1.00
R4717:Aldh3b2 UTSW 19 3981128 missense probably damaging 1.00
R4865:Aldh3b2 UTSW 19 3978469 missense probably damaging 1.00
R5093:Aldh3b2 UTSW 19 3979433 missense probably benign 0.00
R7035:Aldh3b2 UTSW 19 3978142 missense probably benign 0.23
R7223:Aldh3b2 UTSW 19 3979592 missense probably damaging 0.98
R8076:Aldh3b2 UTSW 19 3978859 missense possibly damaging 0.60
R8394:Aldh3b2 UTSW 19 3979461 missense probably benign 0.07
R8701:Aldh3b2 UTSW 19 3978448 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCAGCATAACAGCTTAAC -3'
(R):5'- GTGTCAGATGAGTAAGAGCCCG -3'

Sequencing Primer
(F):5'- GTTGCTTGCCCAAAGTCTCAGAAG -3'
(R):5'- TCAGATGAGTAAGAGCCCGTCTAAC -3'
Posted On 2020-06-30