Incidental Mutation 'R0702:Pgbd5'
ID63056
Institutional Source Beutler Lab
Gene Symbol Pgbd5
Ensembl Gene ENSMUSG00000050751
Gene NamepiggyBac transposable element derived 5
Synonyms
MMRRC Submission 038885-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0702 (G1)
Quality Score122
Status Not validated
Chromosome8
Chromosomal Location124369049-124439658 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 124374255 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 421 (V421M)
Ref Sequence ENSEMBL: ENSMUSP00000120984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052580] [ENSMUST00000136892] [ENSMUST00000140012] [ENSMUST00000172566]
Predicted Effect probably benign
Transcript: ENSMUST00000052580
AA Change: V307M

PolyPhen 2 Score 0.214 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000054788
Gene: ENSMUSG00000050751
AA Change: V307M

DomainStartEndE-ValueType
Pfam:DDE_Tnp_1_7 6 372 5e-86 PFAM
low complexity region 392 403 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128312
Predicted Effect probably benign
Transcript: ENSMUST00000136892
AA Change: V307M

PolyPhen 2 Score 0.214 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000123265
Gene: ENSMUSG00000050751
AA Change: V307M

DomainStartEndE-ValueType
Pfam:DDE_Tnp_1_7 6 372 5e-86 PFAM
low complexity region 392 403 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140012
AA Change: V421M

PolyPhen 2 Score 0.214 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000120984
Gene: ENSMUSG00000050751
AA Change: V421M

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
low complexity region 47 60 N/A INTRINSIC
Pfam:DDE_Tnp_1_7 120 486 5.6e-90 PFAM
low complexity region 506 517 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140126
Predicted Effect probably benign
Transcript: ENSMUST00000172566
AA Change: V330M

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000133560
Gene: ENSMUSG00000050751
AA Change: V330M

DomainStartEndE-ValueType
Pfam:DDE_Tnp_1_7 29 395 2e-86 PFAM
low complexity region 415 426 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: The piggyBac family of proteins, found in diverse animals, are transposases related to the transposase of the canonical piggyBac transposon from the moth, Trichoplusia ni. This family also includes genes in several genomes that appear to have been derived from the piggyBac transposons. This gene belongs to the subfamily of piggyBac transposable element derived (PGBD) genes. The PGBD proteins appear to be novel, with no obvious relationship to other transposases, or other known protein families. The exact function of this gene is not known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd11 A T 8: 122,889,766 I2428N probably damaging Het
Ano9 A G 7: 141,107,282 V348A probably damaging Het
Cfap69 A G 5: 5,644,465 I132T probably benign Het
Chd1l C T 3: 97,566,794 D791N probably benign Het
Chl1 A G 6: 103,706,622 Y819C probably damaging Het
Col5a2 T A 1: 45,380,131 D1263V possibly damaging Het
Csnk1g1 C T 9: 66,010,493 R45W probably damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Dgat2l6 G A X: 100,542,681 V180M probably damaging Het
Fscb G A 12: 64,472,001 P897L unknown Het
Herc6 T C 6: 57,581,107 L24P probably damaging Het
Il23r T A 6: 67,466,285 Q278L probably damaging Het
Kpna4 A T 3: 69,084,105 V361D probably damaging Het
Muc1 A G 3: 89,230,220 D123G probably benign Het
Notch4 A G 17: 34,575,203 Y722C probably damaging Het
Ntng1 G C 3: 109,872,254 R336G probably damaging Het
Olfr199 T C 16: 59,215,699 M305V probably benign Het
Prkdc A G 16: 15,785,971 T2950A possibly damaging Het
Proser3 A T 7: 30,539,530 D630E probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Serpina3g A G 12: 104,241,253 E225G probably damaging Het
Slc2a13 T C 15: 91,321,667 D439G probably benign Het
Srebf2 T C 15: 82,177,409 L352P probably damaging Het
Trpc5 A G X: 144,411,739 V590A probably damaging Het
Ubqln2 A T X: 153,499,669 M406L possibly damaging Het
Other mutations in Pgbd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01642:Pgbd5 APN 8 124384202 missense probably benign 0.00
IGL01669:Pgbd5 APN 8 124374399 missense possibly damaging 0.86
IGL01759:Pgbd5 APN 8 124384379 missense probably damaging 1.00
IGL01762:Pgbd5 APN 8 124370610 missense probably damaging 1.00
IGL02398:Pgbd5 APN 8 124384518 missense probably damaging 1.00
R0348:Pgbd5 UTSW 8 124434032 missense probably damaging 0.98
R0981:Pgbd5 UTSW 8 124384293 nonsense probably null
R1259:Pgbd5 UTSW 8 124370585 missense probably damaging 0.98
R1598:Pgbd5 UTSW 8 124374287 missense probably benign 0.26
R1609:Pgbd5 UTSW 8 124434011 missense probably benign 0.00
R1742:Pgbd5 UTSW 8 124380307 missense probably damaging 1.00
R1938:Pgbd5 UTSW 8 124374249 nonsense probably null
R1985:Pgbd5 UTSW 8 124370592 missense probably benign 0.00
R2169:Pgbd5 UTSW 8 124384624 critical splice acceptor site probably null
R4573:Pgbd5 UTSW 8 124376227 nonsense probably null
R4917:Pgbd5 UTSW 8 124370566 missense probably benign 0.14
R4918:Pgbd5 UTSW 8 124370566 missense probably benign 0.14
R4946:Pgbd5 UTSW 8 124370585 missense possibly damaging 0.93
R5409:Pgbd5 UTSW 8 124371880 missense probably damaging 1.00
R5885:Pgbd5 UTSW 8 124384466 missense probably damaging 1.00
R5946:Pgbd5 UTSW 8 124374317 missense possibly damaging 0.83
R6907:Pgbd5 UTSW 8 124380282 missense probably damaging 0.97
R6986:Pgbd5 UTSW 8 124384473 missense possibly damaging 0.56
R7144:Pgbd5 UTSW 8 124374317 missense possibly damaging 0.83
R7342:Pgbd5 UTSW 8 124433970 missense probably benign 0.36
R7475:Pgbd5 UTSW 8 124434011 missense probably benign 0.00
X0067:Pgbd5 UTSW 8 124371912 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGCCAATCAAGGCAAGCTAAGAG -3'
(R):5'- GCCAATGAAGAGCCCCGTTGATAAG -3'

Sequencing Primer
(F):5'- CAAGCTAAGAGCTTCGTGC -3'
(R):5'- ATTAGTTATGGCCTCAGTGACC -3'
Posted On2013-07-30