Incidental Mutation 'R8103:Ece1'
ID630563
Institutional Source Beutler Lab
Gene Symbol Ece1
Ensembl Gene ENSMUSG00000057530
Gene Nameendothelin converting enzyme 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.765) question?
Stock #R8103 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location137862237-137965229 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 137913822 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 19 (S19P)
Ref Sequence ENSEMBL: ENSMUSP00000099576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102518] [ENSMUST00000130407] [ENSMUST00000151110]
Predicted Effect probably benign
Transcript: ENSMUST00000102518
AA Change: S19P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099576
Gene: ENSMUSG00000057530
AA Change: S19P

DomainStartEndE-ValueType
transmembrane domain 52 74 N/A INTRINSIC
Pfam:Peptidase_M13_N 105 490 1.2e-112 PFAM
Pfam:Peptidase_M13 549 752 1.8e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130407
AA Change: S19P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000151110
AA Change: S35P

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000114671
Gene: ENSMUSG00000057530
AA Change: S35P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Peptidase_M13_N 121 206 1.4e-29 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.7%
  • 20x: 95.4%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in proteolytic processing of endothelin precursors to biologically active peptides. Mutations in this gene are associated with Hirschsprung disease, cardiac defects and autonomic dysfunction. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations show cardiac and craniofacial abnormalities and embryonic mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,067,834 D216G probably benign Het
4930430F08Rik C A 10: 100,577,248 V178F probably benign Het
9030624J02Rik T C 7: 118,743,632 S47P probably benign Het
Abcg5 A T 17: 84,658,528 I640K possibly damaging Het
Acadvl T C 11: 70,014,342 K128R probably benign Het
Angptl7 T A 4: 148,496,561 N259I probably damaging Het
Ankrd35 A G 3: 96,679,681 K104R possibly damaging Het
Antxr1 T C 6: 87,188,216 N413S probably damaging Het
Arhgap26 A G 18: 39,371,124 T376A Het
Atf6b T G 17: 34,653,975 S622A probably damaging Het
Atp5h T A 11: 115,416,025 Y115F possibly damaging Het
Axin2 T C 11: 108,931,543 L307P probably damaging Het
B4galnt4 C T 7: 141,064,651 T153M possibly damaging Het
Brd8 A G 18: 34,607,178 V604A probably benign Het
Ccser2 T C 14: 36,896,283 Y765C probably damaging Het
Cdh26 A G 2: 178,468,213 D433G probably damaging Het
Cep85l T G 10: 53,299,324 probably null Het
Col23a1 T A 11: 51,570,187 probably null Het
Col7a1 A G 9: 108,975,384 D2261G unknown Het
Comp C A 8: 70,381,286 N650K probably damaging Het
Copb1 A G 7: 114,234,967 M476T possibly damaging Het
Dapk1 T A 13: 60,749,195 S743T probably damaging Het
Ddx39 A G 8: 83,724,476 probably null Het
Dgkb A G 12: 38,136,581 H243R probably damaging Het
Dsg1c T G 18: 20,283,114 Y691D probably damaging Het
Duox2 C T 2: 122,287,054 S933N probably benign Het
Edem1 G A 6: 108,852,563 E548K probably damaging Het
Fpr-rs6 A G 17: 20,182,577 V174A possibly damaging Het
Fyco1 A T 9: 123,829,388 N574K probably benign Het
Glb1l2 T A 9: 26,765,684 M551L probably benign Het
Gm3376 C T Y: 3,776,675 T104I possibly damaging Het
Gm5580 C T 6: 116,551,507 T115I probably damaging Het
Gm7694 G T 1: 170,302,715 P38Q probably damaging Het
Grip1 A G 10: 119,978,535 T324A probably benign Het
Htr3b A G 9: 48,946,549 V131A possibly damaging Het
Igfbp1 T C 11: 7,198,106 C50R probably damaging Het
Il5ra A G 6: 106,715,650 I378T possibly damaging Het
Ints11 T C 4: 155,888,230 L504P possibly damaging Het
Iqca A T 1: 90,059,608 I74N Het
Kbtbd12 C T 6: 88,618,681 A56T probably damaging Het
Kcnq5 T C 1: 21,479,396 N369S possibly damaging Het
Kmt5b A G 19: 3,815,381 D815G probably benign Het
Lnpk T C 2: 74,522,255 Q361R probably benign Het
Mep1b T C 18: 21,089,385 I277T possibly damaging Het
Naip6 G A 13: 100,301,343 T385I probably benign Het
Narfl A G 17: 25,777,421 T135A probably benign Het
Npepl1 A T 2: 174,111,209 I95F probably benign Het
Nxpe4 T C 9: 48,392,720 F36L probably benign Het
Olfr129 A T 17: 38,055,012 C185S probably damaging Het
Olfr393 C T 11: 73,847,909 C72Y probably damaging Het
Optn C A 2: 5,040,202 C243F probably damaging Het
Paqr7 T C 4: 134,507,510 V226A probably benign Het
Pcdh12 T A 18: 38,282,159 I638F probably damaging Het
Pfas T C 11: 68,992,293 T722A probably damaging Het
Pkhd1 T A 1: 20,200,757 I3191F probably damaging Het
Plxnc1 T A 10: 94,871,082 H531L probably benign Het
Pom121l2 A G 13: 21,982,374 T272A probably benign Het
Pparg T C 6: 115,473,141 V367A possibly damaging Het
Psen2 A T 1: 180,240,791 M99K probably damaging Het
Ranbp10 T C 8: 105,772,547 T536A probably benign Het
Rbfox2 G T 15: 77,099,454 P284T probably damaging Het
Rere G A 4: 150,617,339 R25H probably damaging Het
Rhpn1 T A 15: 75,709,266 L119Q probably null Het
Rreb1 A G 13: 37,941,701 T1328A probably benign Het
Sept11 A T 5: 93,161,148 probably null Het
Skida1 T A 2: 18,047,738 Q201L probably benign Het
Sptan1 T A 2: 30,020,043 I1805N probably damaging Het
Stard13 T A 5: 151,046,970 Q853L possibly damaging Het
Susd1 T A 4: 59,365,916 probably null Het
Szt2 T A 4: 118,387,864 Q1158H possibly damaging Het
Tbcc A C 17: 46,891,120 D144A probably benign Het
Tsn A G 1: 118,304,707 I146T probably benign Het
Umad1 A T 6: 8,427,121 T99S probably damaging Het
Vcan C A 13: 89,703,320 E1174* probably null Het
Vcan T A 13: 89,657,658 E3261V probably damaging Het
Vmn2r100 C A 17: 19,531,153 probably null Het
Vmn2r65 A G 7: 84,946,711 I255T probably damaging Het
Wdr70 A G 15: 7,977,131 L313P possibly damaging Het
Ythdf2 C A 4: 132,204,778 R357L probably damaging Het
Zfp523 T C 17: 28,201,293 C262R probably damaging Het
Zfp553 T C 7: 127,236,764 V497A probably benign Het
Zhx1 A G 15: 58,053,266 L528S probably benign Het
Other mutations in Ece1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Ece1 APN 4 137938658 missense probably damaging 1.00
IGL01538:Ece1 APN 4 137948544 missense probably benign
IGL01588:Ece1 APN 4 137957206 splice site probably benign
IGL01678:Ece1 APN 4 137962733 missense probably damaging 1.00
IGL02619:Ece1 APN 4 137938733 missense probably benign 0.08
IGL02936:Ece1 APN 4 137946301 missense probably benign 0.01
IGL02956:Ece1 APN 4 137962838 missense probably damaging 0.99
IGL03332:Ece1 APN 4 137946355 missense probably damaging 0.99
R0063:Ece1 UTSW 4 137948581 missense probably benign 0.14
R0240:Ece1 UTSW 4 137949435 splice site probably benign
R1004:Ece1 UTSW 4 137926239 missense probably benign 0.04
R1515:Ece1 UTSW 4 137951508 missense probably benign 0.00
R1541:Ece1 UTSW 4 137948660 splice site probably null
R1796:Ece1 UTSW 4 137958001 missense probably damaging 1.00
R1834:Ece1 UTSW 4 137958001 missense probably damaging 1.00
R1834:Ece1 UTSW 4 137958128 missense probably damaging 0.99
R1836:Ece1 UTSW 4 137958001 missense probably damaging 1.00
R1930:Ece1 UTSW 4 137938763 missense probably benign 0.01
R1931:Ece1 UTSW 4 137938763 missense probably benign 0.01
R2065:Ece1 UTSW 4 137958082 missense probably benign 0.04
R2281:Ece1 UTSW 4 137946362 missense possibly damaging 0.93
R3118:Ece1 UTSW 4 137948544 missense probably benign
R4720:Ece1 UTSW 4 137957175 missense probably damaging 1.00
R4773:Ece1 UTSW 4 137945153 missense probably benign 0.00
R5794:Ece1 UTSW 4 137956533 missense probably damaging 0.99
R5969:Ece1 UTSW 4 137961740 critical splice donor site probably null
R6056:Ece1 UTSW 4 137961647 missense probably damaging 1.00
R6332:Ece1 UTSW 4 137958008 missense probably damaging 1.00
R6648:Ece1 UTSW 4 137921159 missense probably benign 0.00
R7285:Ece1 UTSW 4 137913763 splice site probably null
R7387:Ece1 UTSW 4 137938784 missense possibly damaging 0.69
R8294:Ece1 UTSW 4 137948620 missense possibly damaging 0.60
R8308:Ece1 UTSW 4 137936764 missense probably damaging 0.99
R8806:Ece1 UTSW 4 137945141 missense probably damaging 1.00
X0063:Ece1 UTSW 4 137926375 missense probably damaging 0.97
Z1176:Ece1 UTSW 4 137921027 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- AGGCTTTGCTGACCCTTAGTC -3'
(R):5'- TGGAAACCAGCCTCAGAGTACC -3'

Sequencing Primer
(F):5'- GGGACCTCATTGTAAAAGAAACCTC -3'
(R):5'- TCAGAGTACCGCTGCACAG -3'
Posted On2020-06-30