Incidental Mutation 'R0702:Csnk1g1'
ID63057
Institutional Source Beutler Lab
Gene Symbol Csnk1g1
Ensembl Gene ENSMUSG00000032384
Gene Namecasein kinase 1, gamma 1
Synonyms9130020E21Rik
MMRRC Submission 038885-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.239) question?
Stock #R0702 (G1)
Quality Score115
Status Not validated
Chromosome9
Chromosomal Location65908924-66045015 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 66010493 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 45 (R45W)
Ref Sequence ENSEMBL: ENSMUSP00000146283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034949] [ENSMUST00000117849] [ENSMUST00000130798] [ENSMUST00000136773] [ENSMUST00000205379] [ENSMUST00000206048] [ENSMUST00000206528] [ENSMUST00000206594] [ENSMUST00000206969] [ENSMUST00000208011]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034949
AA Change: R308W

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034949
Gene: ENSMUSG00000032384
AA Change: R308W

DomainStartEndE-ValueType
Pfam:Pkinase 44 302 2.5e-27 PFAM
Pfam:Pkinase_Tyr 44 308 1.5e-14 PFAM
Pfam:CK1gamma_C 331 429 2.8e-35 PFAM
low complexity region 434 440 N/A INTRINSIC
low complexity region 442 453 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117849
AA Change: R308W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113160
Gene: ENSMUSG00000032384
AA Change: R308W

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 44 309 2.3e-14 PFAM
Pfam:Pkinase 44 313 1.5e-35 PFAM
Pfam:CK1gamma_C 331 392 4e-20 PFAM
low complexity region 397 403 N/A INTRINSIC
low complexity region 414 424 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130798
AA Change: R308W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000136773
AA Change: R22W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153391
Predicted Effect possibly damaging
Transcript: ENSMUST00000205379
AA Change: R308W

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect unknown
Transcript: ENSMUST00000205884
AA Change: R81W
Predicted Effect possibly damaging
Transcript: ENSMUST00000206048
AA Change: R308W

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000206528
AA Change: R308W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect possibly damaging
Transcript: ENSMUST00000206594
AA Change: R308W

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000206969
AA Change: R45W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000208011
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the casein kinase I gene family. This family is comprised of serine/threonine kinases that phosphorylate acidic proteins such as caseins. The encoded kinase plays a role in cell cycle checkpoint arrest in response to stalled replication forks by phosphorylating Claspin. A mutation in this gene may be associated with non-syndromic early-onset epilepsy (NSEOE). [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd11 A T 8: 122,889,766 I2428N probably damaging Het
Ano9 A G 7: 141,107,282 V348A probably damaging Het
Cfap69 A G 5: 5,644,465 I132T probably benign Het
Chd1l C T 3: 97,566,794 D791N probably benign Het
Chl1 A G 6: 103,706,622 Y819C probably damaging Het
Col5a2 T A 1: 45,380,131 D1263V possibly damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Dgat2l6 G A X: 100,542,681 V180M probably damaging Het
Fscb G A 12: 64,472,001 P897L unknown Het
Herc6 T C 6: 57,581,107 L24P probably damaging Het
Il23r T A 6: 67,466,285 Q278L probably damaging Het
Kpna4 A T 3: 69,084,105 V361D probably damaging Het
Muc1 A G 3: 89,230,220 D123G probably benign Het
Notch4 A G 17: 34,575,203 Y722C probably damaging Het
Ntng1 G C 3: 109,872,254 R336G probably damaging Het
Olfr199 T C 16: 59,215,699 M305V probably benign Het
Pgbd5 C T 8: 124,374,255 V421M probably benign Het
Prkdc A G 16: 15,785,971 T2950A possibly damaging Het
Proser3 A T 7: 30,539,530 D630E probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Serpina3g A G 12: 104,241,253 E225G probably damaging Het
Slc2a13 T C 15: 91,321,667 D439G probably benign Het
Srebf2 T C 15: 82,177,409 L352P probably damaging Het
Trpc5 A G X: 144,411,739 V590A probably damaging Het
Ubqln2 A T X: 153,499,669 M406L possibly damaging Het
Other mutations in Csnk1g1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Csnk1g1 APN 9 66007746 missense probably damaging 1.00
IGL02073:Csnk1g1 APN 9 66002251 missense probably damaging 1.00
IGL02452:Csnk1g1 APN 9 66007785 missense probably damaging 1.00
R0448:Csnk1g1 UTSW 9 65980948 missense possibly damaging 0.92
R0482:Csnk1g1 UTSW 9 66010469 missense probably damaging 1.00
R0726:Csnk1g1 UTSW 9 66032355 splice site probably benign
R1736:Csnk1g1 UTSW 9 66019915 splice site probably null
R1815:Csnk1g1 UTSW 9 66032324 missense probably damaging 1.00
R2063:Csnk1g1 UTSW 9 66002230 missense probably damaging 1.00
R4366:Csnk1g1 UTSW 9 66019853 missense probably benign 0.02
R4382:Csnk1g1 UTSW 9 66019908 missense probably damaging 1.00
R4384:Csnk1g1 UTSW 9 66019908 missense probably damaging 1.00
R4385:Csnk1g1 UTSW 9 66019908 missense probably damaging 1.00
R6783:Csnk1g1 UTSW 9 65973512 missense probably damaging 1.00
R7877:Csnk1g1 UTSW 9 65999548 critical splice donor site probably null
R7960:Csnk1g1 UTSW 9 65999548 critical splice donor site probably null
Z1177:Csnk1g1 UTSW 9 66012750 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGTGAGAACTTTCCAGGTAGGATGC -3'
(R):5'- CTCCTCAAAGATTCGAGCAGAAGGAC -3'

Sequencing Primer
(F):5'- GCCAATGTGACTGTCACTTCAAAG -3'
(R):5'- CTGGCAAGTAAAAAGATGGGGTG -3'
Posted On2013-07-30