Incidental Mutation 'R8103:Ddx39'
ID630582
Institutional Source Beutler Lab
Gene Symbol Ddx39
Ensembl Gene ENSMUSG00000005481
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 39
Synonyms2610307C23Rik, BAT1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.922) question?
Stock #R8103 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location83715177-83726892 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to G at 83724476 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002964] [ENSMUST00000019576] [ENSMUST00000075843] [ENSMUST00000109802] [ENSMUST00000109810] [ENSMUST00000140521] [ENSMUST00000166939] [ENSMUST00000172396] [ENSMUST00000212949]
Predicted Effect silent
Transcript: ENSMUST00000002964
SMART Domains Protein: ENSMUSP00000002964
Gene: ENSMUSG00000002885

DomainStartEndE-ValueType
EGF 30 68 1.63e1 SMART
EGF_CA 69 119 5.92e-8 SMART
EGF_CA 120 167 1.78e-11 SMART
GPS 384 430 2.18e-8 SMART
Pfam:Dicty_CAR 431 703 1.3e-8 PFAM
Pfam:7tm_2 432 672 8.1e-68 PFAM
low complexity region 704 714 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000019576
SMART Domains Protein: ENSMUSP00000019576
Gene: ENSMUSG00000005481

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
DEXDc 63 264 4.06e-54 SMART
HELICc 300 381 9.09e-25 SMART
Predicted Effect silent
Transcript: ENSMUST00000075843
SMART Domains Protein: ENSMUSP00000075240
Gene: ENSMUSG00000002885

DomainStartEndE-ValueType
EGF 30 68 1.63e1 SMART
EGF_CA 69 119 5.92e-8 SMART
EGF_CA 165 213 1.38e-8 SMART
EGF_CA 214 261 1.78e-11 SMART
GPS 478 524 2.18e-8 SMART
Pfam:Dicty_CAR 525 798 4.6e-8 PFAM
Pfam:7tm_2 526 766 5.3e-68 PFAM
Predicted Effect silent
Transcript: ENSMUST00000109802
SMART Domains Protein: ENSMUSP00000105427
Gene: ENSMUSG00000002885

DomainStartEndE-ValueType
EGF 30 68 1.63e1 SMART
EGF_CA 69 119 5.92e-8 SMART
EGF_CA 120 168 1.38e-8 SMART
EGF_CA 169 216 1.78e-11 SMART
GPS 433 479 2.18e-8 SMART
Pfam:Dicty_CAR 480 752 5.3e-8 PFAM
Pfam:7tm_2 481 721 7.5e-67 PFAM
low complexity region 753 763 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109810
SMART Domains Protein: ENSMUSP00000105435
Gene: ENSMUSG00000005481

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
DEXDc 63 264 4.06e-54 SMART
HELICc 300 381 9.09e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140521
SMART Domains Protein: ENSMUSP00000116101
Gene: ENSMUSG00000005481

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
DEXDc 63 208 2.82e-21 SMART
Predicted Effect silent
Transcript: ENSMUST00000166939
SMART Domains Protein: ENSMUSP00000128220
Gene: ENSMUSG00000002885

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
EGF 28 66 1.63e1 SMART
EGF_CA 67 117 5.92e-8 SMART
EGF_CA 118 165 1.78e-11 SMART
GPS 382 428 2.18e-8 SMART
Pfam:Dicty_CAR 429 701 2.1e-7 PFAM
Pfam:7tm_2 430 670 1.7e-66 PFAM
low complexity region 702 712 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000172396
SMART Domains Protein: ENSMUSP00000132222
Gene: ENSMUSG00000005481

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
DEXDc 63 264 4.06e-54 SMART
HELICc 300 381 9.09e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212949
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.7%
  • 20x: 95.4%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAD box protein family. These proteins are characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD) and are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of the DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene is thought to play a role in the prognosis of patients with gastrointestinal stromal tumors. A pseudogene of this gene is present on chromosome 13. Alternate splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,067,834 D216G probably benign Het
4930430F08Rik C A 10: 100,577,248 V178F probably benign Het
9030624J02Rik T C 7: 118,743,632 S47P probably benign Het
Abcg5 A T 17: 84,658,528 I640K possibly damaging Het
Acadvl T C 11: 70,014,342 K128R probably benign Het
Angptl7 T A 4: 148,496,561 N259I probably damaging Het
Ankrd35 A G 3: 96,679,681 K104R possibly damaging Het
Antxr1 T C 6: 87,188,216 N413S probably damaging Het
Arhgap26 A G 18: 39,371,124 T376A Het
Atf6b T G 17: 34,653,975 S622A probably damaging Het
Atp5h T A 11: 115,416,025 Y115F possibly damaging Het
Axin2 T C 11: 108,931,543 L307P probably damaging Het
B4galnt4 C T 7: 141,064,651 T153M possibly damaging Het
Brd8 A G 18: 34,607,178 V604A probably benign Het
Ccser2 T C 14: 36,896,283 Y765C probably damaging Het
Cdh26 A G 2: 178,468,213 D433G probably damaging Het
Cep85l T G 10: 53,299,324 probably null Het
Col23a1 T A 11: 51,570,187 probably null Het
Col7a1 A G 9: 108,975,384 D2261G unknown Het
Comp C A 8: 70,381,286 N650K probably damaging Het
Copb1 A G 7: 114,234,967 M476T possibly damaging Het
Dapk1 T A 13: 60,749,195 S743T probably damaging Het
Dgkb A G 12: 38,136,581 H243R probably damaging Het
Dsg1c T G 18: 20,283,114 Y691D probably damaging Het
Duox2 C T 2: 122,287,054 S933N probably benign Het
Ece1 T C 4: 137,913,822 S19P probably benign Het
Edem1 G A 6: 108,852,563 E548K probably damaging Het
Fpr-rs6 A G 17: 20,182,577 V174A possibly damaging Het
Fyco1 A T 9: 123,829,388 N574K probably benign Het
Glb1l2 T A 9: 26,765,684 M551L probably benign Het
Gm3376 C T Y: 3,776,675 T104I possibly damaging Het
Gm5580 C T 6: 116,551,507 T115I probably damaging Het
Gm7694 G T 1: 170,302,715 P38Q probably damaging Het
Grip1 A G 10: 119,978,535 T324A probably benign Het
Htr3b A G 9: 48,946,549 V131A possibly damaging Het
Igfbp1 T C 11: 7,198,106 C50R probably damaging Het
Il5ra A G 6: 106,715,650 I378T possibly damaging Het
Ints11 T C 4: 155,888,230 L504P possibly damaging Het
Iqca A T 1: 90,059,608 I74N Het
Kbtbd12 C T 6: 88,618,681 A56T probably damaging Het
Kcnq5 T C 1: 21,479,396 N369S possibly damaging Het
Kmt5b A G 19: 3,815,381 D815G probably benign Het
Lnpk T C 2: 74,522,255 Q361R probably benign Het
Mep1b T C 18: 21,089,385 I277T possibly damaging Het
Naip6 G A 13: 100,301,343 T385I probably benign Het
Narfl A G 17: 25,777,421 T135A probably benign Het
Npepl1 A T 2: 174,111,209 I95F probably benign Het
Nxpe4 T C 9: 48,392,720 F36L probably benign Het
Olfr129 A T 17: 38,055,012 C185S probably damaging Het
Olfr393 C T 11: 73,847,909 C72Y probably damaging Het
Optn C A 2: 5,040,202 C243F probably damaging Het
Paqr7 T C 4: 134,507,510 V226A probably benign Het
Pcdh12 T A 18: 38,282,159 I638F probably damaging Het
Pfas T C 11: 68,992,293 T722A probably damaging Het
Pkhd1 T A 1: 20,200,757 I3191F probably damaging Het
Plxnc1 T A 10: 94,871,082 H531L probably benign Het
Pom121l2 A G 13: 21,982,374 T272A probably benign Het
Pparg T C 6: 115,473,141 V367A possibly damaging Het
Psen2 A T 1: 180,240,791 M99K probably damaging Het
Ranbp10 T C 8: 105,772,547 T536A probably benign Het
Rbfox2 G T 15: 77,099,454 P284T probably damaging Het
Rere G A 4: 150,617,339 R25H probably damaging Het
Rhpn1 T A 15: 75,709,266 L119Q probably null Het
Rreb1 A G 13: 37,941,701 T1328A probably benign Het
Sept11 A T 5: 93,161,148 probably null Het
Skida1 T A 2: 18,047,738 Q201L probably benign Het
Sptan1 T A 2: 30,020,043 I1805N probably damaging Het
Stard13 T A 5: 151,046,970 Q853L possibly damaging Het
Susd1 T A 4: 59,365,916 probably null Het
Szt2 T A 4: 118,387,864 Q1158H possibly damaging Het
Tbcc A C 17: 46,891,120 D144A probably benign Het
Tsn A G 1: 118,304,707 I146T probably benign Het
Umad1 A T 6: 8,427,121 T99S probably damaging Het
Vcan T A 13: 89,657,658 E3261V probably damaging Het
Vcan C A 13: 89,703,320 E1174* probably null Het
Vmn2r100 C A 17: 19,531,153 probably null Het
Vmn2r65 A G 7: 84,946,711 I255T probably damaging Het
Wdr70 A G 15: 7,977,131 L313P possibly damaging Het
Ythdf2 C A 4: 132,204,778 R357L probably damaging Het
Zfp523 T C 17: 28,201,293 C262R probably damaging Het
Zfp553 T C 7: 127,236,764 V497A probably benign Het
Zhx1 A G 15: 58,053,266 L528S probably benign Het
Other mutations in Ddx39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02544:Ddx39 APN 8 83722773 missense probably benign 0.03
IGL02712:Ddx39 APN 8 83721757 missense probably benign 0.03
R0038:Ddx39 UTSW 8 83722498 missense probably damaging 1.00
R0038:Ddx39 UTSW 8 83722498 missense probably damaging 1.00
R0051:Ddx39 UTSW 8 83720622 missense possibly damaging 0.83
R0051:Ddx39 UTSW 8 83720622 missense possibly damaging 0.83
R0143:Ddx39 UTSW 8 83720550 missense probably benign 0.22
R0147:Ddx39 UTSW 8 83722476 missense possibly damaging 0.74
R0148:Ddx39 UTSW 8 83722476 missense possibly damaging 0.74
R0392:Ddx39 UTSW 8 83721737 missense probably damaging 0.97
R0426:Ddx39 UTSW 8 83721769 missense probably benign 0.00
R0830:Ddx39 UTSW 8 83719823 missense possibly damaging 0.47
R1509:Ddx39 UTSW 8 83719898 missense probably damaging 1.00
R2935:Ddx39 UTSW 8 83720958 missense possibly damaging 0.57
R3082:Ddx39 UTSW 8 83722706 missense possibly damaging 0.57
R4050:Ddx39 UTSW 8 83722234 missense probably benign 0.00
R4647:Ddx39 UTSW 8 83722273 missense probably benign 0.00
R4804:Ddx39 UTSW 8 83721095 missense probably damaging 0.99
R5242:Ddx39 UTSW 8 83721811 missense probably benign 0.01
R5268:Ddx39 UTSW 8 83722321 missense probably benign 0.08
R6598:Ddx39 UTSW 8 83722927 missense probably benign 0.03
R6805:Ddx39 UTSW 8 83723137 missense probably damaging 1.00
R6852:Ddx39 UTSW 8 83723017 missense probably benign 0.03
R7326:Ddx39 UTSW 8 83722471 missense probably benign 0.31
R7559:Ddx39 UTSW 8 83720966 missense possibly damaging 0.82
R7803:Ddx39 UTSW 8 83719600 critical splice donor site probably null
X0026:Ddx39 UTSW 8 83722330 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGATGTAGGATAGCCATGTGC -3'
(R):5'- TGGACTTTAGGAAGCAGGGC -3'

Sequencing Primer
(F):5'- CATGTGCTATGGGGGTTGAAGAG -3'
(R):5'- AGCAGGGCTTTCTCTGGAGC -3'
Posted On2020-06-30