Incidental Mutation 'R8103:Rbfox2'
ID630610
Institutional Source Beutler Lab
Gene Symbol Rbfox2
Ensembl Gene ENSMUSG00000033565
Gene NameRNA binding protein, fox-1 homolog (C. elegans) 2
Synonyms2810460A15Rik, Fxh, Fbm2, Rbm9
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.672) question?
Stock #R8103 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location77078990-77307004 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 77099454 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 284 (P284T)
Ref Sequence ENSEMBL: ENSMUSP00000130739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048145] [ENSMUST00000111581] [ENSMUST00000166610] [ENSMUST00000171751] [ENSMUST00000227314] [ENSMUST00000227533] [ENSMUST00000227930] [ENSMUST00000228087] [ENSMUST00000228558]
Predicted Effect probably damaging
Transcript: ENSMUST00000048145
AA Change: P284T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048056
Gene: ENSMUSG00000033565
AA Change: P284T

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 91 107 N/A INTRINSIC
low complexity region 139 150 N/A INTRINSIC
low complexity region 156 178 N/A INTRINSIC
RRM 181 252 1.77e-24 SMART
Pfam:Fox-1_C 319 374 2.9e-18 PFAM
low complexity region 375 390 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111581
AA Change: P216T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129372
Gene: ENSMUSG00000033565
AA Change: P216T

DomainStartEndE-ValueType
low complexity region 23 39 N/A INTRINSIC
low complexity region 71 82 N/A INTRINSIC
low complexity region 88 110 N/A INTRINSIC
RRM 113 184 1.77e-24 SMART
Pfam:Fox-1_C 252 350 3.7e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166610
AA Change: P216T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130673
Gene: ENSMUSG00000033565
AA Change: P216T

DomainStartEndE-ValueType
low complexity region 23 39 N/A INTRINSIC
low complexity region 71 82 N/A INTRINSIC
low complexity region 88 110 N/A INTRINSIC
RRM 113 184 1.77e-24 SMART
Pfam:Fox-1_C 255 353 6.2e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171751
AA Change: P284T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130739
Gene: ENSMUSG00000033565
AA Change: P284T

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 91 107 N/A INTRINSIC
low complexity region 139 150 N/A INTRINSIC
low complexity region 156 178 N/A INTRINSIC
RRM 181 252 1.77e-24 SMART
Pfam:Fox-1_C 324 421 7e-47 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000227314
AA Change: P216T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000227533
AA Change: P184T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000227930
AA Change: P118T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000228087
AA Change: P216T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000228558
AA Change: P238T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.7%
  • 20x: 95.4%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of several human genes similar to the C. elegans gene Fox-1. This gene encodes an RNA binding protein that is thought to be a key regulator of alternative exon splicing in the nervous system and other cell types. The protein binds to a conserved UGCAUG element found downstream of many alternatively spliced exons and promotes inclusion of the alternative exon in mature transcripts. The protein also interacts with the estrogen receptor 1 transcription factor and regulates estrogen receptor 1 transcriptional activity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in the brain exhibit normal spontaneous and kainic acid-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,067,834 D216G probably benign Het
4930430F08Rik C A 10: 100,577,248 V178F probably benign Het
9030624J02Rik T C 7: 118,743,632 S47P probably benign Het
Abcg5 A T 17: 84,658,528 I640K possibly damaging Het
Acadvl T C 11: 70,014,342 K128R probably benign Het
Angptl7 T A 4: 148,496,561 N259I probably damaging Het
Ankrd35 A G 3: 96,679,681 K104R possibly damaging Het
Antxr1 T C 6: 87,188,216 N413S probably damaging Het
Arhgap26 A G 18: 39,371,124 T376A Het
Atf6b T G 17: 34,653,975 S622A probably damaging Het
Atp5h T A 11: 115,416,025 Y115F possibly damaging Het
Axin2 T C 11: 108,931,543 L307P probably damaging Het
B4galnt4 C T 7: 141,064,651 T153M possibly damaging Het
Brd8 A G 18: 34,607,178 V604A probably benign Het
Ccser2 T C 14: 36,896,283 Y765C probably damaging Het
Cdh26 A G 2: 178,468,213 D433G probably damaging Het
Cep85l T G 10: 53,299,324 probably null Het
Col23a1 T A 11: 51,570,187 probably null Het
Col7a1 A G 9: 108,975,384 D2261G unknown Het
Comp C A 8: 70,381,286 N650K probably damaging Het
Copb1 A G 7: 114,234,967 M476T possibly damaging Het
Dapk1 T A 13: 60,749,195 S743T probably damaging Het
Ddx39 A G 8: 83,724,476 probably null Het
Dgkb A G 12: 38,136,581 H243R probably damaging Het
Dsg1c T G 18: 20,283,114 Y691D probably damaging Het
Duox2 C T 2: 122,287,054 S933N probably benign Het
Ece1 T C 4: 137,913,822 S19P probably benign Het
Edem1 G A 6: 108,852,563 E548K probably damaging Het
Fpr-rs6 A G 17: 20,182,577 V174A possibly damaging Het
Fyco1 A T 9: 123,829,388 N574K probably benign Het
Glb1l2 T A 9: 26,765,684 M551L probably benign Het
Gm3376 C T Y: 3,776,675 T104I possibly damaging Het
Gm5580 C T 6: 116,551,507 T115I probably damaging Het
Gm7694 G T 1: 170,302,715 P38Q probably damaging Het
Grip1 A G 10: 119,978,535 T324A probably benign Het
Htr3b A G 9: 48,946,549 V131A possibly damaging Het
Igfbp1 T C 11: 7,198,106 C50R probably damaging Het
Il5ra A G 6: 106,715,650 I378T possibly damaging Het
Ints11 T C 4: 155,888,230 L504P possibly damaging Het
Iqca A T 1: 90,059,608 I74N Het
Kbtbd12 C T 6: 88,618,681 A56T probably damaging Het
Kcnq5 T C 1: 21,479,396 N369S possibly damaging Het
Kmt5b A G 19: 3,815,381 D815G probably benign Het
Lnpk T C 2: 74,522,255 Q361R probably benign Het
Mep1b T C 18: 21,089,385 I277T possibly damaging Het
Naip6 G A 13: 100,301,343 T385I probably benign Het
Narfl A G 17: 25,777,421 T135A probably benign Het
Npepl1 A T 2: 174,111,209 I95F probably benign Het
Nxpe4 T C 9: 48,392,720 F36L probably benign Het
Olfr129 A T 17: 38,055,012 C185S probably damaging Het
Olfr393 C T 11: 73,847,909 C72Y probably damaging Het
Optn C A 2: 5,040,202 C243F probably damaging Het
Paqr7 T C 4: 134,507,510 V226A probably benign Het
Pcdh12 T A 18: 38,282,159 I638F probably damaging Het
Pfas T C 11: 68,992,293 T722A probably damaging Het
Pkhd1 T A 1: 20,200,757 I3191F probably damaging Het
Plxnc1 T A 10: 94,871,082 H531L probably benign Het
Pom121l2 A G 13: 21,982,374 T272A probably benign Het
Pparg T C 6: 115,473,141 V367A possibly damaging Het
Psen2 A T 1: 180,240,791 M99K probably damaging Het
Ranbp10 T C 8: 105,772,547 T536A probably benign Het
Rere G A 4: 150,617,339 R25H probably damaging Het
Rhpn1 T A 15: 75,709,266 L119Q probably null Het
Rreb1 A G 13: 37,941,701 T1328A probably benign Het
Sept11 A T 5: 93,161,148 probably null Het
Skida1 T A 2: 18,047,738 Q201L probably benign Het
Sptan1 T A 2: 30,020,043 I1805N probably damaging Het
Stard13 T A 5: 151,046,970 Q853L possibly damaging Het
Susd1 T A 4: 59,365,916 probably null Het
Szt2 T A 4: 118,387,864 Q1158H possibly damaging Het
Tbcc A C 17: 46,891,120 D144A probably benign Het
Tsn A G 1: 118,304,707 I146T probably benign Het
Umad1 A T 6: 8,427,121 T99S probably damaging Het
Vcan T A 13: 89,657,658 E3261V probably damaging Het
Vcan C A 13: 89,703,320 E1174* probably null Het
Vmn2r100 C A 17: 19,531,153 probably null Het
Vmn2r65 A G 7: 84,946,711 I255T probably damaging Het
Wdr70 A G 15: 7,977,131 L313P possibly damaging Het
Ythdf2 C A 4: 132,204,778 R357L probably damaging Het
Zfp523 T C 17: 28,201,293 C262R probably damaging Het
Zfp553 T C 7: 127,236,764 V497A probably benign Het
Zhx1 A G 15: 58,053,266 L528S probably benign Het
Other mutations in Rbfox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Rbfox2 APN 15 77102936 missense probably damaging 1.00
R0026:Rbfox2 UTSW 15 77084157 missense possibly damaging 0.66
R0130:Rbfox2 UTSW 15 77091857 intron probably benign
R0446:Rbfox2 UTSW 15 77099255 missense probably damaging 0.98
R0731:Rbfox2 UTSW 15 77099279 missense probably benign 0.21
R3013:Rbfox2 UTSW 15 77132920 missense probably damaging 1.00
R3715:Rbfox2 UTSW 15 77099251 missense probably damaging 0.97
R4094:Rbfox2 UTSW 15 77132725 missense probably damaging 0.99
R4543:Rbfox2 UTSW 15 77306368 missense probably benign 0.01
R4799:Rbfox2 UTSW 15 77091818 missense probably benign 0.28
R6194:Rbfox2 UTSW 15 77084157 missense possibly damaging 0.66
R7316:Rbfox2 UTSW 15 77132729 missense possibly damaging 0.92
R7501:Rbfox2 UTSW 15 77105634 missense probably benign 0.36
R7687:Rbfox2 UTSW 15 77306494 missense unknown
R8030:Rbfox2 UTSW 15 77085576 critical splice donor site probably null
RF027:Rbfox2 UTSW 15 77132773 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCTTCCTGACAAGGGCACAG -3'
(R):5'- CAGCTTTATCATCAAGGGAAGTCAG -3'

Sequencing Primer
(F):5'- ACAGCCGCCTCATTGCCTAG -3'
(R):5'- GGAAGTCAGGGCAGCTTTC -3'
Posted On2020-06-30