Incidental Mutation 'R8103:Pcdh12'
ID630620
Institutional Source Beutler Lab
Gene Symbol Pcdh12
Ensembl Gene ENSMUSG00000024440
Gene Nameprotocadherin 12
SynonymsVE-cadherin-2, vascular endothelial cadherin-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8103 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location38267092-38284402 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38282159 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 638 (I638F)
Ref Sequence ENSEMBL: ENSMUSP00000025311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025311] [ENSMUST00000194012]
Predicted Effect probably damaging
Transcript: ENSMUST00000025311
AA Change: I638F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025311
Gene: ENSMUSG00000024440
AA Change: I638F

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
CA 53 133 4.42e-2 SMART
CA 157 242 2.55e-17 SMART
CA 266 350 2.31e-24 SMART
CA 376 458 3.86e-26 SMART
CA 482 563 6.27e-26 SMART
CA 621 704 3.02e-2 SMART
transmembrane domain 716 738 N/A INTRINSIC
low complexity region 960 975 N/A INTRINSIC
low complexity region 1032 1041 N/A INTRINSIC
low complexity region 1115 1125 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194012
SMART Domains Protein: ENSMUSP00000141907
Gene: ENSMUSG00000024440

DomainStartEndE-ValueType
low complexity region 56 66 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.7%
  • 20x: 95.4%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The encoded protein consists of an extracellular domain containing 6 cadherin repeats, a transmembrane domain and a cytoplasmic tail that differs from those of the classical cadherins. The gene localizes to the region on chromosome 5 where the protocadherin gene clusters reside. The exon organization of this transcript is similar to that of the gene cluster transcripts, notably the first large exon, but no significant sequence homology exists. The function of this cellular adhesion protein is undetermined but mouse protocadherin 12 does not bind catenins and appears to have no affect on cell migration or growth. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation are viable, fertile and do not display any obvious histomorphological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,067,834 D216G probably benign Het
4930430F08Rik C A 10: 100,577,248 V178F probably benign Het
9030624J02Rik T C 7: 118,743,632 S47P probably benign Het
Abcg5 A T 17: 84,658,528 I640K possibly damaging Het
Acadvl T C 11: 70,014,342 K128R probably benign Het
Angptl7 T A 4: 148,496,561 N259I probably damaging Het
Ankrd35 A G 3: 96,679,681 K104R possibly damaging Het
Antxr1 T C 6: 87,188,216 N413S probably damaging Het
Arhgap26 A G 18: 39,371,124 T376A Het
Atf6b T G 17: 34,653,975 S622A probably damaging Het
Atp5h T A 11: 115,416,025 Y115F possibly damaging Het
Axin2 T C 11: 108,931,543 L307P probably damaging Het
B4galnt4 C T 7: 141,064,651 T153M possibly damaging Het
Brd8 A G 18: 34,607,178 V604A probably benign Het
Ccser2 T C 14: 36,896,283 Y765C probably damaging Het
Cdh26 A G 2: 178,468,213 D433G probably damaging Het
Cep85l T G 10: 53,299,324 probably null Het
Col23a1 T A 11: 51,570,187 probably null Het
Col7a1 A G 9: 108,975,384 D2261G unknown Het
Comp C A 8: 70,381,286 N650K probably damaging Het
Copb1 A G 7: 114,234,967 M476T possibly damaging Het
Dapk1 T A 13: 60,749,195 S743T probably damaging Het
Ddx39 A G 8: 83,724,476 probably null Het
Dgkb A G 12: 38,136,581 H243R probably damaging Het
Dsg1c T G 18: 20,283,114 Y691D probably damaging Het
Duox2 C T 2: 122,287,054 S933N probably benign Het
Ece1 T C 4: 137,913,822 S19P probably benign Het
Edem1 G A 6: 108,852,563 E548K probably damaging Het
Fpr-rs6 A G 17: 20,182,577 V174A possibly damaging Het
Fyco1 A T 9: 123,829,388 N574K probably benign Het
Glb1l2 T A 9: 26,765,684 M551L probably benign Het
Gm3376 C T Y: 3,776,675 T104I possibly damaging Het
Gm5580 C T 6: 116,551,507 T115I probably damaging Het
Gm7694 G T 1: 170,302,715 P38Q probably damaging Het
Grip1 A G 10: 119,978,535 T324A probably benign Het
Htr3b A G 9: 48,946,549 V131A possibly damaging Het
Igfbp1 T C 11: 7,198,106 C50R probably damaging Het
Il5ra A G 6: 106,715,650 I378T possibly damaging Het
Ints11 T C 4: 155,888,230 L504P possibly damaging Het
Iqca A T 1: 90,059,608 I74N Het
Kbtbd12 C T 6: 88,618,681 A56T probably damaging Het
Kcnq5 T C 1: 21,479,396 N369S possibly damaging Het
Kmt5b A G 19: 3,815,381 D815G probably benign Het
Lnpk T C 2: 74,522,255 Q361R probably benign Het
Mep1b T C 18: 21,089,385 I277T possibly damaging Het
Naip6 G A 13: 100,301,343 T385I probably benign Het
Narfl A G 17: 25,777,421 T135A probably benign Het
Npepl1 A T 2: 174,111,209 I95F probably benign Het
Nxpe4 T C 9: 48,392,720 F36L probably benign Het
Olfr129 A T 17: 38,055,012 C185S probably damaging Het
Olfr393 C T 11: 73,847,909 C72Y probably damaging Het
Optn C A 2: 5,040,202 C243F probably damaging Het
Paqr7 T C 4: 134,507,510 V226A probably benign Het
Pfas T C 11: 68,992,293 T722A probably damaging Het
Pkhd1 T A 1: 20,200,757 I3191F probably damaging Het
Plxnc1 T A 10: 94,871,082 H531L probably benign Het
Pom121l2 A G 13: 21,982,374 T272A probably benign Het
Pparg T C 6: 115,473,141 V367A possibly damaging Het
Psen2 A T 1: 180,240,791 M99K probably damaging Het
Ranbp10 T C 8: 105,772,547 T536A probably benign Het
Rbfox2 G T 15: 77,099,454 P284T probably damaging Het
Rere G A 4: 150,617,339 R25H probably damaging Het
Rhpn1 T A 15: 75,709,266 L119Q probably null Het
Rreb1 A G 13: 37,941,701 T1328A probably benign Het
Sept11 A T 5: 93,161,148 probably null Het
Skida1 T A 2: 18,047,738 Q201L probably benign Het
Sptan1 T A 2: 30,020,043 I1805N probably damaging Het
Stard13 T A 5: 151,046,970 Q853L possibly damaging Het
Susd1 T A 4: 59,365,916 probably null Het
Szt2 T A 4: 118,387,864 Q1158H possibly damaging Het
Tbcc A C 17: 46,891,120 D144A probably benign Het
Tsn A G 1: 118,304,707 I146T probably benign Het
Umad1 A T 6: 8,427,121 T99S probably damaging Het
Vcan T A 13: 89,657,658 E3261V probably damaging Het
Vcan C A 13: 89,703,320 E1174* probably null Het
Vmn2r100 C A 17: 19,531,153 probably null Het
Vmn2r65 A G 7: 84,946,711 I255T probably damaging Het
Wdr70 A G 15: 7,977,131 L313P possibly damaging Het
Ythdf2 C A 4: 132,204,778 R357L probably damaging Het
Zfp523 T C 17: 28,201,293 C262R probably damaging Het
Zfp553 T C 7: 127,236,764 V497A probably benign Het
Zhx1 A G 15: 58,053,266 L528S probably benign Het
Other mutations in Pcdh12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Pcdh12 APN 18 38281457 missense probably benign
IGL00964:Pcdh12 APN 18 38282731 missense probably benign 0.27
IGL01105:Pcdh12 APN 18 38275347 missense probably damaging 1.00
IGL02011:Pcdh12 APN 18 38281420 missense probably damaging 1.00
IGL02234:Pcdh12 APN 18 38283535 missense probably damaging 1.00
IGL02452:Pcdh12 APN 18 38281693 missense probably benign 0.00
IGL03412:Pcdh12 APN 18 38283515 missense probably benign 0.24
R0729:Pcdh12 UTSW 18 38282464 missense probably benign 0.20
R1330:Pcdh12 UTSW 18 38281861 missense probably benign 0.13
R1394:Pcdh12 UTSW 18 38281189 critical splice donor site probably null
R1413:Pcdh12 UTSW 18 38283443 missense probably damaging 1.00
R1993:Pcdh12 UTSW 18 38282143 missense possibly damaging 0.62
R2115:Pcdh12 UTSW 18 38283986 missense probably damaging 1.00
R2567:Pcdh12 UTSW 18 38282096 missense probably damaging 1.00
R2926:Pcdh12 UTSW 18 38282390 missense probably damaging 0.99
R3810:Pcdh12 UTSW 18 38281237 missense probably damaging 1.00
R3813:Pcdh12 UTSW 18 38283614 nonsense probably null
R5275:Pcdh12 UTSW 18 38284101 utr 5 prime probably benign
R5400:Pcdh12 UTSW 18 38268898 missense probably damaging 1.00
R5523:Pcdh12 UTSW 18 38283139 missense probably damaging 1.00
R5539:Pcdh12 UTSW 18 38281744 missense possibly damaging 0.77
R5604:Pcdh12 UTSW 18 38268882 missense probably damaging 1.00
R6012:Pcdh12 UTSW 18 38283752 missense probably damaging 1.00
R6042:Pcdh12 UTSW 18 38281505 missense probably damaging 1.00
R6129:Pcdh12 UTSW 18 38277859 missense probably damaging 1.00
R6239:Pcdh12 UTSW 18 38282401 missense probably damaging 1.00
R6508:Pcdh12 UTSW 18 38281337 nonsense probably null
R7250:Pcdh12 UTSW 18 38281976 missense probably benign
R7259:Pcdh12 UTSW 18 38281624 missense probably benign 0.00
R7271:Pcdh12 UTSW 18 38283047 missense probably damaging 1.00
R7489:Pcdh12 UTSW 18 38281789 missense possibly damaging 0.77
R8157:Pcdh12 UTSW 18 38282797 missense probably benign
R8322:Pcdh12 UTSW 18 38281577 nonsense probably null
R8503:Pcdh12 UTSW 18 38282521 missense possibly damaging 0.86
R8510:Pcdh12 UTSW 18 38282056 missense possibly damaging 0.89
Z1177:Pcdh12 UTSW 18 38282992 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CACGACCTTCAATGAAACTTGG -3'
(R):5'- ATGCCCCAGAAGTGATTCAGC -3'

Sequencing Primer
(F):5'- CGACCTTCAATGAAACTTGGGTCTG -3'
(R):5'- CAGAAGTGATTCAGCCTGTGC -3'
Posted On2020-06-30