Mutagenetix > Incidental Mutation

Incidental Mutation 'R8104:Slc9a2'

630624

Institutional Source

Beutler Lab

Gene Symbol

Slc9a2

Ensembl Gene

ENSMUSG00000026062

Gene Name

solute carrier family 9 (sodium/hydrogen exchanger), member 2

Synonyms

2210416H12Rik, 4932415O19Rik, NHE2

MMRRC Submission

067535-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.058) question?

Stock #

R8104 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

40680574-40769273 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 40718649 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 116 (I116K)

Ref Sequence

ENSEMBL: ENSMUSP00000027231 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027231] [ENSMUST00000192345]

AlphaFold

Q3ZAS0

Predicted Effect

probably damaging
Transcript: ENSMUST00000027231
AA Change: I116K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000027231
Gene: ENSMUSG00000026062
AA Change: I116K

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
low complexity region	40	60	N/A	INTRINSIC
Pfam:Na_H_Exchanger	85	486	1.4e-95	PFAM
low complexity region	528	543	N/A	INTRINSIC
Pfam:NEXCaM_BD	576	685	3e-44	PFAM
low complexity region	738	753	N/A	INTRINSIC
low complexity region	788	793	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000192345
AA Change: I116K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000142144
Gene: ENSMUSG00000026062
AA Change: I116K

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
low complexity region	40	60	N/A	INTRINSIC
Pfam:Na_H_Exchanger	85	336	2.5e-56	PFAM

Coding Region Coverage

1x: 99.8%
3x: 99.5%
10x: 98.6%
20x: 94.6%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium-hydrogen exchanger (NHE) protein family. These proteins are involved in sodium-ion transport by exchanging intracellular hydrogen ions to external sodium ions and help in the regulation of cell pH and volume. The encoded protein is localized to the apical membrane and is involved in apical absorption of sodium. [provided by RefSeq, Jun 2016]
PHENOTYPE: Gastric acid secretion is impaired in homozygous mutant mice. The gastric mucosa becomes inflamed and exhibits an altered cellular composition. Mutant mice do not breed well. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsbg2	C	A	17: 56,845,443	L666F	probably benign	Het
Adgrv1	A	T	13: 81,440,225	V4414E	possibly damaging	Het
Apoc3	T	G	9: 46,233,287	D79A	probably damaging	Het
Arfgap1	T	A	2: 180,979,229		probably null	Het
Ascc1	T	C	10: 60,007,729	S38P	probably benign	Het
Asl	C	T	5: 130,011,950	E389K	probably benign	Het
Atat1	A	T	17: 35,904,116	I215K	probably benign	Het
BC067074	T	A	13: 113,319,729	F770I		Het
Bod1l	A	T	5: 41,833,732	L160*	probably null	Het
Cbl	C	A	9: 44,158,539	S637I	possibly damaging	Het
Ccdc112	A	C	18: 46,287,653	S343R	probably benign	Het
Cr1l	A	G	1: 195,117,617	S250P	possibly damaging	Het
Dlgap3	A	G	4: 127,236,154	E907G	probably damaging	Het
Dsp	A	T	13: 38,168,624	E159D	probably benign	Het
Ech1	G	A	7: 28,825,303		probably benign	Het
Erbin	G	T	13: 103,834,977	N710K	possibly damaging	Het
Fbxw28	A	T	9: 109,326,289		probably null	Het
Gm4871	G	C	5: 145,032,202	D100E	probably damaging	Het
Got1l1	A	G	8: 27,197,591	I388T	probably damaging	Het
Ing5	T	A	1: 93,816,444	N184K	probably damaging	Het
Izumo3	A	T	4: 92,146,908	L24*	probably null	Het
Lig1	T	C	7: 13,286,565	V99A	possibly damaging	Het
Mbtps1	A	G	8: 119,529,055	Y488H	possibly damaging	Het
Muc5ac	A	G	7: 141,804,783	Y1240C	possibly damaging	Het
Nav3	T	C	10: 109,758,967	T1458A	probably damaging	Het
Nedd1	T	C	10: 92,691,916	E472G	probably damaging	Het
Nod2	A	T	8: 88,665,057	H664L	possibly damaging	Het
Ntrk3	A	G	7: 78,577,702	S28P	probably damaging	Het
Olfr1357	C	T	10: 78,612,408	V78I	probably benign	Het
Olfr298	A	G	7: 86,489,023	F176S	probably damaging	Het
Olfr699	C	A	7: 106,791,130		probably benign	Het
Olfr699	T	A	7: 106,791,131		probably benign	Het
Olfr792	T	A	10: 129,540,957	M140K	probably benign	Het
Pcdha4	G	T	18: 36,954,053	G430W	probably damaging	Het
Pcnx	T	A	12: 81,983,611	Y1114*	probably null	Het
Pde6a	T	A	18: 61,231,494	D207E	probably damaging	Het
Plekhg1	T	A	10: 3,952,326	I540N		Het
Pnp2	A	T	14: 50,959,642	I62F	probably benign	Het
Rarg	C	A	15: 102,239,899	D258Y	probably damaging	Het
Rnps1	T	A	17: 24,424,510	M262K	unknown	Het
Scaf11	T	C	15: 96,418,602	D1027G	probably benign	Het
Serpina3a	A	T	12: 104,112,851		probably benign	Het
Slc25a1	A	G	16: 17,926,433		probably null	Het
Slc44a3	A	C	3: 121,497,872	V365G	probably benign	Het
Slc45a3	T	C	1: 131,977,016	F26L	probably benign	Het
Stk36	T	A	1: 74,626,597	S700T	probably benign	Het
Tekt3	A	G	11: 63,078,119	D224G	probably benign	Het
Tgtp1	A	T	11: 48,987,014	I288N	probably damaging	Het
Ttn	C	T	2: 76,880,223	V8485M	unknown	Het
Tubg1	G	T	11: 101,124,028	A199S	probably benign	Het
Uso1	T	A	5: 92,158,421	I79K	probably damaging	Het
Utp20	C	T	10: 88,757,904	D2215N	probably damaging	Het
Wdr43	C	T	17: 71,616,355	A32V	probably benign	Het
Zfp704	T	C	3: 9,565,241	D170G	probably benign	Het

Other mutations in Slc9a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Slc9a2	APN	1	40767737	missense	probably benign
IGL00487:Slc9a2	APN	1	40742658	missense	probably damaging	0.99
IGL00500:Slc9a2	APN	1	40763583	missense	possibly damaging	0.95
IGL01445:Slc9a2	APN	1	40718810	missense	possibly damaging	0.51
IGL02060:Slc9a2	APN	1	40756293	missense	probably damaging	0.99
IGL02813:Slc9a2	APN	1	40742669	missense	probably damaging	1.00
IGL02894:Slc9a2	APN	1	40763602	missense	probably benign	0.20
IGL02939:Slc9a2	APN	1	40742703	missense	probably damaging	1.00
IGL03193:Slc9a2	APN	1	40756271	missense	probably benign	0.00
putty	UTSW	1	40742653	nonsense	probably null
E0370:Slc9a2	UTSW	1	40763541	critical splice acceptor site	probably null
PIT4377001:Slc9a2	UTSW	1	40743841	missense	probably damaging	1.00
R0009:Slc9a2	UTSW	1	40763602	missense	probably benign	0.38
R0009:Slc9a2	UTSW	1	40763602	missense	probably benign	0.38
R0152:Slc9a2	UTSW	1	40742804	missense	probably damaging	1.00
R0374:Slc9a2	UTSW	1	40743857	missense	possibly damaging	0.93
R1386:Slc9a2	UTSW	1	40719018	missense	probably damaging	1.00
R1485:Slc9a2	UTSW	1	40726388	missense	probably damaging	1.00
R1712:Slc9a2	UTSW	1	40763610	missense	possibly damaging	0.90
R1779:Slc9a2	UTSW	1	40742643	missense	probably damaging	0.99
R2051:Slc9a2	UTSW	1	40726437	missense	probably damaging	1.00
R2166:Slc9a2	UTSW	1	40742768	missense	probably damaging	1.00
R2513:Slc9a2	UTSW	1	40742608	splice site	probably null
R3612:Slc9a2	UTSW	1	40719058	splice site	probably null
R4631:Slc9a2	UTSW	1	40761918	missense	possibly damaging	0.66
R4760:Slc9a2	UTSW	1	40761916	missense	probably damaging	1.00
R4768:Slc9a2	UTSW	1	40726374	missense	probably damaging	1.00
R4769:Slc9a2	UTSW	1	40726374	missense	probably damaging	1.00
R4815:Slc9a2	UTSW	1	40718849	missense	probably benign	0.00
R4920:Slc9a2	UTSW	1	40755718	missense	probably benign	0.05
R5191:Slc9a2	UTSW	1	40743893	missense	probably damaging	1.00
R5963:Slc9a2	UTSW	1	40682036	missense	possibly damaging	0.94
R6322:Slc9a2	UTSW	1	40742653	nonsense	probably null
R6453:Slc9a2	UTSW	1	40742621	missense	possibly damaging	0.64
R6685:Slc9a2	UTSW	1	40718909	missense	probably damaging	0.99
R7088:Slc9a2	UTSW	1	40726379	missense	probably damaging	1.00
R7302:Slc9a2	UTSW	1	40767668	missense	possibly damaging	0.58
R7450:Slc9a2	UTSW	1	40681835	start gained	probably benign
R7670:Slc9a2	UTSW	1	40718997	missense	probably damaging	1.00
R7970:Slc9a2	UTSW	1	40726214	missense	probably damaging	0.98
R8776:Slc9a2	UTSW	1	40742729	missense	probably damaging	1.00
R8776-TAIL:Slc9a2	UTSW	1	40742729	missense	probably damaging	1.00
R8887:Slc9a2	UTSW	1	40718849	missense	probably benign	0.01
R9028:Slc9a2	UTSW	1	40726452	missense	probably damaging	1.00
R9189:Slc9a2	UTSW	1	40755784	missense	probably benign	0.21
R9245:Slc9a2	UTSW	1	40766300	missense	probably benign	0.27
R9250:Slc9a2	UTSW	1	40767827	missense	probably benign	0.00
R9400:Slc9a2	UTSW	1	40719051	missense	possibly damaging	0.65
R9512:Slc9a2	UTSW	1	40682098	missense	probably damaging	0.98
R9583:Slc9a2	UTSW	1	40681901	missense	probably benign
X0054:Slc9a2	UTSW	1	40742687	missense	probably damaging	0.99
Z1176:Slc9a2	UTSW	1	40767711	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGTGGGCCGTTTTGCAATATG -3'
(R):5'- CCCCAATGCCAATGGAATTC -3'

Sequencing Primer
(F):5'- CCGTTTTGCAATATGGAAGCCAC -3'
(R):5'- GGAATTCCACAGTGTGCCTAC -3'

Posted On

2020-06-30