Incidental Mutation 'R0702:Slc2a13'
ID63063
Institutional Source Beutler Lab
Gene Symbol Slc2a13
Ensembl Gene ENSMUSG00000036298
Gene Namesolute carrier family 2 (facilitated glucose transporter), member 13
SynonymsA630029G22Rik
MMRRC Submission 038885-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0702 (G1)
Quality Score164
Status Not validated
Chromosome15
Chromosomal Location91267696-91573261 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91321667 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 439 (D439G)
Ref Sequence ENSEMBL: ENSMUSP00000104906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109283]
Predicted Effect probably benign
Transcript: ENSMUST00000109283
AA Change: D439G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104906
Gene: ENSMUSG00000036298
AA Change: D439G

DomainStartEndE-ValueType
low complexity region 36 54 N/A INTRINSIC
Pfam:Sugar_tr 73 412 2e-87 PFAM
Pfam:MFS_1 77 411 6.6e-23 PFAM
Pfam:Sugar_tr 487 598 8.1e-28 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd11 A T 8: 122,889,766 I2428N probably damaging Het
Ano9 A G 7: 141,107,282 V348A probably damaging Het
Cfap69 A G 5: 5,644,465 I132T probably benign Het
Chd1l C T 3: 97,566,794 D791N probably benign Het
Chl1 A G 6: 103,706,622 Y819C probably damaging Het
Col5a2 T A 1: 45,380,131 D1263V possibly damaging Het
Csnk1g1 C T 9: 66,010,493 R45W probably damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Dgat2l6 G A X: 100,542,681 V180M probably damaging Het
Fscb G A 12: 64,472,001 P897L unknown Het
Herc6 T C 6: 57,581,107 L24P probably damaging Het
Il23r T A 6: 67,466,285 Q278L probably damaging Het
Kpna4 A T 3: 69,084,105 V361D probably damaging Het
Muc1 A G 3: 89,230,220 D123G probably benign Het
Notch4 A G 17: 34,575,203 Y722C probably damaging Het
Ntng1 G C 3: 109,872,254 R336G probably damaging Het
Olfr199 T C 16: 59,215,699 M305V probably benign Het
Pgbd5 C T 8: 124,374,255 V421M probably benign Het
Prkdc A G 16: 15,785,971 T2950A possibly damaging Het
Proser3 A T 7: 30,539,530 D630E probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Serpina3g A G 12: 104,241,253 E225G probably damaging Het
Srebf2 T C 15: 82,177,409 L352P probably damaging Het
Trpc5 A G X: 144,411,739 V590A probably damaging Het
Ubqln2 A T X: 153,499,669 M406L possibly damaging Het
Other mutations in Slc2a13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Slc2a13 APN 15 91497399 missense probably benign
IGL01295:Slc2a13 APN 15 91350132 critical splice acceptor site probably null
IGL01863:Slc2a13 APN 15 91516492 missense probably benign 0.00
IGL02149:Slc2a13 APN 15 91343721 missense probably benign
IGL02670:Slc2a13 APN 15 91497509 missense probably damaging 0.99
IGL02692:Slc2a13 APN 15 91321658 missense probably benign 0.23
IGL03307:Slc2a13 APN 15 91276114 missense probably damaging 0.98
R0394:Slc2a13 UTSW 15 91516392 missense probably damaging 1.00
R0624:Slc2a13 UTSW 15 91350012 missense possibly damaging 0.89
R0698:Slc2a13 UTSW 15 91321667 missense probably benign
R1052:Slc2a13 UTSW 15 91412160 missense probably damaging 0.96
R2090:Slc2a13 UTSW 15 91516492 missense probably benign 0.00
R2118:Slc2a13 UTSW 15 91516476 missense probably damaging 0.99
R4445:Slc2a13 UTSW 15 91350020 missense possibly damaging 0.46
R4896:Slc2a13 UTSW 15 91412212 missense probably benign 0.20
R6028:Slc2a13 UTSW 15 91276116 missense probably damaging 1.00
R6414:Slc2a13 UTSW 15 91343805 missense probably benign 0.00
R6836:Slc2a13 UTSW 15 91321632 missense probably benign 0.00
R6928:Slc2a13 UTSW 15 91276179 missense probably damaging 1.00
R7353:Slc2a13 UTSW 15 91321604 missense probably benign
R7423:Slc2a13 UTSW 15 91572680 missense probably damaging 1.00
R7458:Slc2a13 UTSW 15 91412187 missense probably benign 0.04
R7641:Slc2a13 UTSW 15 91272156 makesense probably null
R7993:Slc2a13 UTSW 15 91412153 nonsense probably null
R8057:Slc2a13 UTSW 15 91516416 missense probably damaging 0.99
R8164:Slc2a13 UTSW 15 91276078 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GAGGCTGAGCTGAGAACTTTTACCC -3'
(R):5'- GCAGCTATCACCTGGATCTGCTTAC -3'

Sequencing Primer
(F):5'- GCTGAGAACTTTTACCCGATGAC -3'
(R):5'- GCTTACATCACTTGTCTTAGCCAAAG -3'
Posted On2013-07-30