Incidental Mutation 'R8104:Slc44a3'
ID 630632
Institutional Source Beutler Lab
Gene Symbol Slc44a3
Ensembl Gene ENSMUSG00000039865
Gene Name solute carrier family 44, member 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8104 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 121459528-121532404 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 121497872 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 365 (V365G)
Ref Sequence ENSEMBL: ENSMUSP00000040210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039197]
AlphaFold Q921V7
Predicted Effect probably benign
Transcript: ENSMUST00000039197
AA Change: V365G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000040210
Gene: ENSMUSG00000039865
AA Change: V365G

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 217 239 N/A INTRINSIC
transmembrane domain 244 266 N/A INTRINSIC
Pfam:Choline_transpo 291 607 2.3e-80 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.6%
  • 20x: 94.6%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg2 C A 17: 56,845,443 L666F probably benign Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Apoc3 T G 9: 46,233,287 D79A probably damaging Het
Arfgap1 T A 2: 180,979,229 probably null Het
Ascc1 T C 10: 60,007,729 S38P probably benign Het
Asl C T 5: 130,011,950 E389K probably benign Het
Atat1 A T 17: 35,904,116 I215K probably benign Het
BC067074 T A 13: 113,319,729 F770I Het
Bod1l A T 5: 41,833,732 L160* probably null Het
Cbl C A 9: 44,158,539 S637I possibly damaging Het
Ccdc112 A C 18: 46,287,653 S343R probably benign Het
Cr1l A G 1: 195,117,617 S250P possibly damaging Het
Dlgap3 A G 4: 127,236,154 E907G probably damaging Het
Dsp A T 13: 38,168,624 E159D probably benign Het
Ech1 G A 7: 28,825,303 probably benign Het
Erbin G T 13: 103,834,977 N710K possibly damaging Het
Fbxw28 A T 9: 109,326,289 probably null Het
Gm4871 G C 5: 145,032,202 D100E probably damaging Het
Got1l1 A G 8: 27,197,591 I388T probably damaging Het
Ing5 T A 1: 93,816,444 N184K probably damaging Het
Izumo3 A T 4: 92,146,908 L24* probably null Het
Lig1 T C 7: 13,286,565 V99A possibly damaging Het
Mbtps1 A G 8: 119,529,055 Y488H possibly damaging Het
Muc5ac A G 7: 141,804,783 Y1240C possibly damaging Het
Nav3 T C 10: 109,758,967 T1458A probably damaging Het
Nedd1 T C 10: 92,691,916 E472G probably damaging Het
Nod2 A T 8: 88,665,057 H664L possibly damaging Het
Ntrk3 A G 7: 78,577,702 S28P probably damaging Het
Olfr1357 C T 10: 78,612,408 V78I probably benign Het
Olfr298 A G 7: 86,489,023 F176S probably damaging Het
Olfr699 C A 7: 106,791,130 probably benign Het
Olfr699 T A 7: 106,791,131 probably benign Het
Olfr792 T A 10: 129,540,957 M140K probably benign Het
Pcdha4 G T 18: 36,954,053 G430W probably damaging Het
Pcnx T A 12: 81,983,611 Y1114* probably null Het
Pde6a T A 18: 61,231,494 D207E probably damaging Het
Plekhg1 T A 10: 3,952,326 I540N Het
Pnp2 A T 14: 50,959,642 I62F probably benign Het
Rarg C A 15: 102,239,899 D258Y probably damaging Het
Rnps1 T A 17: 24,424,510 M262K unknown Het
Scaf11 T C 15: 96,418,602 D1027G probably benign Het
Serpina3a A T 12: 104,112,851 probably benign Het
Slc25a1 A G 16: 17,926,433 probably null Het
Slc45a3 T C 1: 131,977,016 F26L probably benign Het
Slc9a2 T A 1: 40,718,649 I116K probably damaging Het
Stk36 T A 1: 74,626,597 S700T probably benign Het
Tekt3 A G 11: 63,078,119 D224G probably benign Het
Tgtp1 A T 11: 48,987,014 I288N probably damaging Het
Ttn C T 2: 76,880,223 V8485M unknown Het
Tubg1 G T 11: 101,124,028 A199S probably benign Het
Uso1 T A 5: 92,158,421 I79K probably damaging Het
Utp20 C T 10: 88,757,904 D2215N probably damaging Het
Wdr43 C T 17: 71,616,355 A32V probably benign Het
Zfp704 T C 3: 9,565,241 D170G probably benign Het
Other mutations in Slc44a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Slc44a3 APN 3 121527193 missense probably damaging 1.00
IGL01527:Slc44a3 APN 3 121527128 missense probably damaging 1.00
IGL02304:Slc44a3 APN 3 121527074 missense possibly damaging 0.48
IGL02419:Slc44a3 APN 3 121490257 missense probably benign 0.03
IGL02836:Slc44a3 APN 3 121531717 missense probably damaging 1.00
IGL02937:Slc44a3 APN 3 121510321 splice site probably benign
IGL03219:Slc44a3 APN 3 121463520 missense probably damaging 1.00
BB009:Slc44a3 UTSW 3 121512360 missense possibly damaging 0.86
BB019:Slc44a3 UTSW 3 121512360 missense possibly damaging 0.86
R0597:Slc44a3 UTSW 3 121460070 missense probably benign
R0668:Slc44a3 UTSW 3 121510203 missense probably damaging 0.96
R1355:Slc44a3 UTSW 3 121531671 missense probably damaging 1.00
R1608:Slc44a3 UTSW 3 121497847 nonsense probably null
R1617:Slc44a3 UTSW 3 121461265 missense probably benign 0.19
R1912:Slc44a3 UTSW 3 121532166 missense probably benign 0.00
R2027:Slc44a3 UTSW 3 121463410 splice site probably benign
R2087:Slc44a3 UTSW 3 121525670 missense probably damaging 0.99
R2199:Slc44a3 UTSW 3 121513744 missense probably benign 0.02
R4707:Slc44a3 UTSW 3 121527074 missense possibly damaging 0.48
R4736:Slc44a3 UTSW 3 121510206 missense probably damaging 0.97
R4784:Slc44a3 UTSW 3 121527074 missense possibly damaging 0.48
R4785:Slc44a3 UTSW 3 121527074 missense possibly damaging 0.48
R5302:Slc44a3 UTSW 3 121510313 missense probably damaging 1.00
R5835:Slc44a3 UTSW 3 121527200 missense probably benign 0.03
R6252:Slc44a3 UTSW 3 121513737 missense probably damaging 0.99
R6991:Slc44a3 UTSW 3 121532165 missense probably benign 0.01
R7197:Slc44a3 UTSW 3 121525762 missense probably benign 0.02
R7227:Slc44a3 UTSW 3 121510230 missense possibly damaging 0.93
R7272:Slc44a3 UTSW 3 121461115 missense probably damaging 0.99
R7932:Slc44a3 UTSW 3 121512360 missense possibly damaging 0.86
R8529:Slc44a3 UTSW 3 121525685 missense probably benign 0.36
R8679:Slc44a3 UTSW 3 121490269 missense probably damaging 1.00
R8856:Slc44a3 UTSW 3 121513807 missense probably damaging 1.00
R9053:Slc44a3 UTSW 3 121527190 missense probably damaging 1.00
R9121:Slc44a3 UTSW 3 121461137 missense probably benign 0.00
R9360:Slc44a3 UTSW 3 121532259 start gained probably benign
Z1176:Slc44a3 UTSW 3 121532251 start gained probably benign
Z1177:Slc44a3 UTSW 3 121497750 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TCAGAGATGCATATACAAGCCAAAG -3'
(R):5'- TCACTGTCAATAGCGTTGGC -3'

Sequencing Primer
(F):5'- AACCTCAGGGATAAAAGAGTGGACTC -3'
(R):5'- GCGTTGGCACTATTTAAATTCTTAG -3'
Posted On 2020-06-30