Incidental Mutation 'R8104:Izumo3'
ID630633
Institutional Source Beutler Lab
Gene Symbol Izumo3
Ensembl Gene ENSMUSG00000028533
Gene NameIZUMO family member 3
Synonyms1700011H22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R8104 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location92144329-92147234 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 92146908 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 24 (L24*)
Ref Sequence ENSEMBL: ENSMUSP00000102725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107108] [ENSMUST00000143542]
Predicted Effect probably null
Transcript: ENSMUST00000107108
AA Change: L24*
SMART Domains Protein: ENSMUSP00000102725
Gene: ENSMUSG00000028533
AA Change: L24*

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
Pfam:IZUMO 22 165 6.7e-44 PFAM
transmembrane domain 179 201 N/A INTRINSIC
low complexity region 214 227 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143542
SMART Domains Protein: ENSMUSP00000121187
Gene: ENSMUSG00000028533

DomainStartEndE-ValueType
Pfam:IZUMO 3 95 4.2e-27 PFAM
transmembrane domain 109 131 N/A INTRINSIC
low complexity region 144 157 N/A INTRINSIC
Meta Mutation Damage Score 0.9718 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.6%
  • 20x: 94.6%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg2 C A 17: 56,845,443 L666F probably benign Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Apoc3 T G 9: 46,233,287 D79A probably damaging Het
Arfgap1 T A 2: 180,979,229 probably null Het
Ascc1 T C 10: 60,007,729 S38P probably benign Het
Asl C T 5: 130,011,950 E389K probably benign Het
Atat1 A T 17: 35,904,116 I215K probably benign Het
BC067074 T A 13: 113,319,729 F770I Het
Bod1l A T 5: 41,833,732 L160* probably null Het
Cbl C A 9: 44,158,539 S637I possibly damaging Het
Ccdc112 A C 18: 46,287,653 S343R probably benign Het
Cr1l A G 1: 195,117,617 S250P possibly damaging Het
Dlgap3 A G 4: 127,236,154 E907G probably damaging Het
Dsp A T 13: 38,168,624 E159D probably benign Het
Ech1 G A 7: 28,825,303 probably benign Het
Erbin G T 13: 103,834,977 N710K possibly damaging Het
Fbxw28 A T 9: 109,326,289 probably null Het
Gm4871 G C 5: 145,032,202 D100E probably damaging Het
Got1l1 A G 8: 27,197,591 I388T probably damaging Het
Ing5 T A 1: 93,816,444 N184K probably damaging Het
Lig1 T C 7: 13,286,565 V99A possibly damaging Het
Mbtps1 A G 8: 119,529,055 Y488H possibly damaging Het
Muc5ac A G 7: 141,804,783 Y1240C possibly damaging Het
Nav3 T C 10: 109,758,967 T1458A probably damaging Het
Nedd1 T C 10: 92,691,916 E472G probably damaging Het
Nod2 A T 8: 88,665,057 H664L possibly damaging Het
Ntrk3 A G 7: 78,577,702 S28P probably damaging Het
Olfr1357 C T 10: 78,612,408 V78I probably benign Het
Olfr298 A G 7: 86,489,023 F176S probably damaging Het
Olfr699 C A 7: 106,791,130 probably benign Het
Olfr699 T A 7: 106,791,131 probably benign Het
Olfr792 T A 10: 129,540,957 M140K probably benign Het
Pcdha4 G T 18: 36,954,053 G430W probably damaging Het
Pcnx T A 12: 81,983,611 Y1114* probably null Het
Pde6a T A 18: 61,231,494 D207E probably damaging Het
Plekhg1 T A 10: 3,952,326 I540N Het
Pnp2 A T 14: 50,959,642 I62F probably benign Het
Rarg C A 15: 102,239,899 D258Y probably damaging Het
Rnps1 T A 17: 24,424,510 M262K unknown Het
Scaf11 T C 15: 96,418,602 D1027G probably benign Het
Serpina3a A T 12: 104,112,851 probably benign Het
Slc25a1 A G 16: 17,926,433 probably null Het
Slc44a3 A C 3: 121,497,872 V365G probably benign Het
Slc45a3 T C 1: 131,977,016 F26L probably benign Het
Slc9a2 T A 1: 40,718,649 I116K probably damaging Het
Stk36 T A 1: 74,626,597 S700T probably benign Het
Tekt3 A G 11: 63,078,119 D224G probably benign Het
Tgtp1 A T 11: 48,987,014 I288N probably damaging Het
Ttn C T 2: 76,880,223 V8485M unknown Het
Tubg1 G T 11: 101,124,028 A199S probably benign Het
Uso1 T A 5: 92,158,421 I79K probably damaging Het
Utp20 C T 10: 88,757,904 D2215N probably damaging Het
Wdr43 C T 17: 71,616,355 A32V probably benign Het
Zfp704 T C 3: 9,565,241 D170G probably benign Het
Other mutations in Izumo3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Izumo3 APN 4 92146980 intron probably benign
IGL01323:Izumo3 APN 4 92146390 splice site probably benign
IGL01586:Izumo3 APN 4 92146295 critical splice donor site probably null
IGL02794:Izumo3 APN 4 92146963 missense probably benign
IGL03146:Izumo3 APN 4 92145039 missense probably damaging 0.97
IGL03180:Izumo3 APN 4 92146287 splice site probably benign
R0053:Izumo3 UTSW 4 92145030 missense probably damaging 0.99
R0137:Izumo3 UTSW 4 92147200 splice site probably benign
R1222:Izumo3 UTSW 4 92145047 missense probably damaging 1.00
R1558:Izumo3 UTSW 4 92146903 missense probably damaging 1.00
R1605:Izumo3 UTSW 4 92144740 missense probably damaging 0.99
R4413:Izumo3 UTSW 4 92146899 missense probably damaging 1.00
R4834:Izumo3 UTSW 4 92146971 missense possibly damaging 0.95
R5362:Izumo3 UTSW 4 92146800 missense possibly damaging 0.87
R7348:Izumo3 UTSW 4 92147218 missense possibly damaging 0.71
R7783:Izumo3 UTSW 4 92145023 missense probably damaging 0.98
R8343:Izumo3 UTSW 4 92146344 missense probably damaging 0.99
Z1088:Izumo3 UTSW 4 92146933 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGACATAGATTGGATCCACTGG -3'
(R):5'- CCAAGACAATGATCTCATTCCTG -3'

Sequencing Primer
(F):5'- GACATAGATTGGATCCACTGGTTTTC -3'
(R):5'- TCCTGGATTTTTGAAGAAGAAGGAAC -3'
Posted On2020-06-30