Incidental Mutation 'R8104:Bod1l'
ID 630634
Institutional Source Beutler Lab
Gene Symbol Bod1l
Ensembl Gene ENSMUSG00000061755
Gene Name biorientation of chromosomes in cell division 1-like
Synonyms A230054D04Rik
MMRRC Submission 067535-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.952) question?
Stock # R8104 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 41944881-42001658 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 41991075 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 160 (L160*)
Ref Sequence ENSEMBL: ENSMUSP00000058618 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050556] [ENSMUST00000202908]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000050556
AA Change: L160*
SMART Domains Protein: ENSMUSP00000058618
Gene: ENSMUSG00000061755
AA Change: L160*

DomainStartEndE-ValueType
low complexity region 5 47 N/A INTRINSIC
Pfam:COMPASS-Shg1 54 150 1.8e-28 PFAM
low complexity region 328 343 N/A INTRINSIC
low complexity region 415 435 N/A INTRINSIC
low complexity region 475 484 N/A INTRINSIC
coiled coil region 495 520 N/A INTRINSIC
coiled coil region 553 580 N/A INTRINSIC
low complexity region 820 840 N/A INTRINSIC
low complexity region 895 916 N/A INTRINSIC
low complexity region 996 1005 N/A INTRINSIC
low complexity region 1023 1041 N/A INTRINSIC
low complexity region 1272 1286 N/A INTRINSIC
low complexity region 1791 1809 N/A INTRINSIC
low complexity region 2695 2701 N/A INTRINSIC
low complexity region 2711 2729 N/A INTRINSIC
AT_hook 2807 2819 3.21e-1 SMART
coiled coil region 2908 2929 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000202908
AA Change: L160*
SMART Domains Protein: ENSMUSP00000144359
Gene: ENSMUSG00000061755
AA Change: L160*

DomainStartEndE-ValueType
low complexity region 5 47 N/A INTRINSIC
Pfam:COMPASS-Shg1 54 150 2.9e-24 PFAM
low complexity region 328 343 N/A INTRINSIC
low complexity region 415 435 N/A INTRINSIC
low complexity region 475 484 N/A INTRINSIC
coiled coil region 495 520 N/A INTRINSIC
coiled coil region 553 580 N/A INTRINSIC
low complexity region 820 840 N/A INTRINSIC
low complexity region 895 916 N/A INTRINSIC
low complexity region 996 1005 N/A INTRINSIC
low complexity region 1023 1041 N/A INTRINSIC
low complexity region 1272 1286 N/A INTRINSIC
low complexity region 1791 1809 N/A INTRINSIC
low complexity region 2695 2701 N/A INTRINSIC
low complexity region 2711 2729 N/A INTRINSIC
AT_hook 2807 2819 1.9e-3 SMART
coiled coil region 2908 2929 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.6%
  • 20x: 94.6%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg2 C A 17: 57,152,443 (GRCm39) L666F probably benign Het
Adgrv1 A T 13: 81,588,344 (GRCm39) V4414E possibly damaging Het
Apoc3 T G 9: 46,144,585 (GRCm39) D79A probably damaging Het
Arfgap1 T A 2: 180,621,022 (GRCm39) probably null Het
Ascc1 T C 10: 59,843,551 (GRCm39) S38P probably benign Het
Asl C T 5: 130,040,791 (GRCm39) E389K probably benign Het
Atat1 A T 17: 36,215,008 (GRCm39) I215K probably benign Het
Cbl C A 9: 44,069,836 (GRCm39) S637I possibly damaging Het
Ccdc112 A C 18: 46,420,720 (GRCm39) S343R probably benign Het
Cr1l A G 1: 194,799,925 (GRCm39) S250P possibly damaging Het
Cspg4b T A 13: 113,456,263 (GRCm39) F770I Het
Dlgap3 A G 4: 127,129,947 (GRCm39) E907G probably damaging Het
Dsp A T 13: 38,352,600 (GRCm39) E159D probably benign Het
Ech1 G A 7: 28,524,728 (GRCm39) probably benign Het
Erbin G T 13: 103,971,485 (GRCm39) N710K possibly damaging Het
Fbxw28 A T 9: 109,155,357 (GRCm39) probably null Het
Gm4871 G C 5: 144,969,012 (GRCm39) D100E probably damaging Het
Got1l1 A G 8: 27,687,619 (GRCm39) I388T probably damaging Het
Ing5 T A 1: 93,744,166 (GRCm39) N184K probably damaging Het
Izumo3 A T 4: 92,035,145 (GRCm39) L24* probably null Het
Lig1 T C 7: 13,020,491 (GRCm39) V99A possibly damaging Het
Mbtps1 A G 8: 120,255,794 (GRCm39) Y488H possibly damaging Het
Muc5ac A G 7: 141,358,520 (GRCm39) Y1240C possibly damaging Het
Nav3 T C 10: 109,594,828 (GRCm39) T1458A probably damaging Het
Nedd1 T C 10: 92,527,778 (GRCm39) E472G probably damaging Het
Nod2 A T 8: 89,391,685 (GRCm39) H664L possibly damaging Het
Ntrk3 A G 7: 78,227,450 (GRCm39) S28P probably damaging Het
Or14a257 A G 7: 86,138,231 (GRCm39) F176S probably damaging Het
Or1i2 C T 10: 78,448,242 (GRCm39) V78I probably benign Het
Or2ag17 T A 7: 106,390,338 (GRCm39) probably benign Het
Or2ag17 C A 7: 106,390,337 (GRCm39) probably benign Het
Or6c66b T A 10: 129,376,826 (GRCm39) M140K probably benign Het
Pcdha4 G T 18: 37,087,106 (GRCm39) G430W probably damaging Het
Pcnx1 T A 12: 82,030,385 (GRCm39) Y1114* probably null Het
Pde6a T A 18: 61,364,566 (GRCm39) D207E probably damaging Het
Plekhg1 T A 10: 3,902,326 (GRCm39) I540N Het
Pnp2 A T 14: 51,197,099 (GRCm39) I62F probably benign Het
Rarg C A 15: 102,148,334 (GRCm39) D258Y probably damaging Het
Rnps1 T A 17: 24,643,484 (GRCm39) M262K unknown Het
Scaf11 T C 15: 96,316,483 (GRCm39) D1027G probably benign Het
Serpina3a A T 12: 104,079,110 (GRCm39) probably benign Het
Slc25a1 A G 16: 17,744,297 (GRCm39) probably null Het
Slc44a3 A C 3: 121,291,521 (GRCm39) V365G probably benign Het
Slc45a3 T C 1: 131,904,754 (GRCm39) F26L probably benign Het
Slc9a2 T A 1: 40,757,809 (GRCm39) I116K probably damaging Het
Stk36 T A 1: 74,665,756 (GRCm39) S700T probably benign Het
Tekt3 A G 11: 62,968,945 (GRCm39) D224G probably benign Het
Tgtp1 A T 11: 48,877,841 (GRCm39) I288N probably damaging Het
Ttn C T 2: 76,710,567 (GRCm39) V8485M unknown Het
Tubg1 G T 11: 101,014,854 (GRCm39) A199S probably benign Het
Uso1 T A 5: 92,306,280 (GRCm39) I79K probably damaging Het
Utp20 C T 10: 88,593,766 (GRCm39) D2215N probably damaging Het
Wdr43 C T 17: 71,923,350 (GRCm39) A32V probably benign Het
Zfp704 T C 3: 9,630,301 (GRCm39) D170G probably benign Het
Other mutations in Bod1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Bod1l APN 5 41,974,166 (GRCm39) missense probably benign 0.00
IGL00990:Bod1l APN 5 41,986,208 (GRCm39) missense probably benign 0.00
IGL01021:Bod1l APN 5 41,995,516 (GRCm39) splice site probably benign
IGL01022:Bod1l APN 5 41,951,652 (GRCm39) missense probably damaging 1.00
IGL01303:Bod1l APN 5 41,974,942 (GRCm39) missense probably benign 0.00
IGL01654:Bod1l APN 5 41,975,519 (GRCm39) missense probably damaging 0.99
IGL01748:Bod1l APN 5 41,974,304 (GRCm39) missense probably benign 0.23
IGL01758:Bod1l APN 5 41,983,953 (GRCm39) splice site probably benign
IGL01783:Bod1l APN 5 41,966,055 (GRCm39) missense probably benign 0.02
IGL01790:Bod1l APN 5 41,989,593 (GRCm39) missense probably benign 0.14
IGL01803:Bod1l APN 5 41,974,732 (GRCm39) missense probably damaging 0.97
IGL01829:Bod1l APN 5 41,977,811 (GRCm39) missense probably benign 0.25
IGL01952:Bod1l APN 5 41,974,297 (GRCm39) missense possibly damaging 0.70
IGL02005:Bod1l APN 5 41,973,682 (GRCm39) missense probably benign 0.01
IGL02110:Bod1l APN 5 41,973,796 (GRCm39) missense probably damaging 0.97
IGL02129:Bod1l APN 5 41,979,193 (GRCm39) missense probably benign 0.36
IGL02572:Bod1l APN 5 41,978,573 (GRCm39) nonsense probably null
IGL02583:Bod1l APN 5 41,973,550 (GRCm39) critical splice donor site probably null
IGL02643:Bod1l APN 5 41,976,148 (GRCm39) missense possibly damaging 0.65
IGL02714:Bod1l APN 5 41,973,682 (GRCm39) missense probably benign 0.01
IGL02728:Bod1l APN 5 41,983,846 (GRCm39) missense probably damaging 1.00
IGL02752:Bod1l APN 5 41,973,806 (GRCm39) missense possibly damaging 0.58
IGL02822:Bod1l APN 5 41,951,688 (GRCm39) missense possibly damaging 0.94
IGL03032:Bod1l APN 5 41,988,927 (GRCm39) missense probably benign 0.16
IGL03372:Bod1l APN 5 41,962,578 (GRCm39) splice site probably benign
capacitance UTSW 5 41,949,156 (GRCm39) missense possibly damaging 0.91
gauss UTSW 5 41,974,210 (GRCm39) missense probably benign 0.01
Tesla UTSW 5 41,952,411 (GRCm39) critical splice donor site probably null
R0102:Bod1l UTSW 5 41,974,612 (GRCm39) missense probably benign 0.36
R0147:Bod1l UTSW 5 41,976,040 (GRCm39) missense possibly damaging 0.48
R0148:Bod1l UTSW 5 41,976,040 (GRCm39) missense possibly damaging 0.48
R0490:Bod1l UTSW 5 41,979,235 (GRCm39) missense probably damaging 0.96
R0577:Bod1l UTSW 5 41,952,230 (GRCm39) missense probably damaging 1.00
R0587:Bod1l UTSW 5 41,978,980 (GRCm39) missense probably benign 0.16
R0620:Bod1l UTSW 5 41,958,576 (GRCm39) missense probably benign 0.16
R0626:Bod1l UTSW 5 41,988,880 (GRCm39) missense probably damaging 1.00
R0785:Bod1l UTSW 5 41,977,359 (GRCm39) missense probably benign 0.00
R1139:Bod1l UTSW 5 41,988,814 (GRCm39) missense possibly damaging 0.64
R1165:Bod1l UTSW 5 41,978,396 (GRCm39) missense probably benign 0.02
R1418:Bod1l UTSW 5 41,976,814 (GRCm39) missense probably damaging 1.00
R1509:Bod1l UTSW 5 41,976,883 (GRCm39) missense probably damaging 0.99
R1533:Bod1l UTSW 5 41,979,498 (GRCm39) nonsense probably null
R1538:Bod1l UTSW 5 41,973,772 (GRCm39) missense probably benign 0.00
R1591:Bod1l UTSW 5 41,976,563 (GRCm39) missense probably benign 0.06
R1616:Bod1l UTSW 5 41,966,058 (GRCm39) missense probably benign
R1628:Bod1l UTSW 5 41,974,325 (GRCm39) missense probably benign 0.01
R1667:Bod1l UTSW 5 41,974,118 (GRCm39) missense probably benign 0.01
R1869:Bod1l UTSW 5 41,991,018 (GRCm39) missense possibly damaging 0.93
R1870:Bod1l UTSW 5 41,991,018 (GRCm39) missense possibly damaging 0.93
R1993:Bod1l UTSW 5 41,974,679 (GRCm39) missense probably damaging 1.00
R2060:Bod1l UTSW 5 41,966,085 (GRCm39) missense possibly damaging 0.58
R2066:Bod1l UTSW 5 41,962,499 (GRCm39) missense probably damaging 0.99
R2067:Bod1l UTSW 5 41,974,429 (GRCm39) missense probably benign 0.11
R2073:Bod1l UTSW 5 41,976,532 (GRCm39) missense probably benign 0.19
R2092:Bod1l UTSW 5 41,988,860 (GRCm39) missense probably damaging 1.00
R2105:Bod1l UTSW 5 41,989,622 (GRCm39) missense probably benign 0.00
R2243:Bod1l UTSW 5 41,978,888 (GRCm39) missense possibly damaging 0.58
R2322:Bod1l UTSW 5 41,984,463 (GRCm39) missense probably benign 0.09
R2849:Bod1l UTSW 5 41,995,419 (GRCm39) missense probably damaging 1.00
R2883:Bod1l UTSW 5 41,989,602 (GRCm39) missense probably benign 0.03
R3037:Bod1l UTSW 5 41,979,380 (GRCm39) missense probably damaging 0.99
R3910:Bod1l UTSW 5 41,974,441 (GRCm39) missense probably damaging 0.99
R3911:Bod1l UTSW 5 41,974,441 (GRCm39) missense probably damaging 0.99
R3962:Bod1l UTSW 5 41,966,064 (GRCm39) missense probably benign 0.07
R4235:Bod1l UTSW 5 41,978,798 (GRCm39) missense probably damaging 1.00
R4308:Bod1l UTSW 5 41,949,156 (GRCm39) missense possibly damaging 0.91
R4414:Bod1l UTSW 5 41,977,870 (GRCm39) missense probably benign 0.04
R4535:Bod1l UTSW 5 41,989,574 (GRCm39) missense probably benign 0.06
R4631:Bod1l UTSW 5 41,975,078 (GRCm39) missense probably damaging 1.00
R4657:Bod1l UTSW 5 41,975,955 (GRCm39) missense probably benign 0.00
R4782:Bod1l UTSW 5 41,991,006 (GRCm39) missense probably benign 0.06
R4786:Bod1l UTSW 5 41,976,781 (GRCm39) missense probably benign 0.43
R4840:Bod1l UTSW 5 41,975,815 (GRCm39) missense probably damaging 1.00
R4877:Bod1l UTSW 5 41,977,337 (GRCm39) missense probably benign 0.00
R4982:Bod1l UTSW 5 41,977,816 (GRCm39) missense probably benign 0.00
R5152:Bod1l UTSW 5 41,973,886 (GRCm39) missense probably benign 0.04
R5284:Bod1l UTSW 5 41,977,810 (GRCm39) missense probably benign 0.05
R5354:Bod1l UTSW 5 41,988,880 (GRCm39) missense probably damaging 1.00
R5369:Bod1l UTSW 5 41,984,526 (GRCm39) missense probably damaging 1.00
R5486:Bod1l UTSW 5 41,964,524 (GRCm39) missense possibly damaging 0.56
R5541:Bod1l UTSW 5 41,949,276 (GRCm39) missense probably benign 0.06
R5610:Bod1l UTSW 5 41,979,217 (GRCm39) missense probably damaging 1.00
R5655:Bod1l UTSW 5 41,974,387 (GRCm39) missense probably benign 0.06
R5705:Bod1l UTSW 5 41,974,345 (GRCm39) missense probably benign 0.01
R5819:Bod1l UTSW 5 41,989,948 (GRCm39) missense probably benign 0.27
R5890:Bod1l UTSW 5 41,977,921 (GRCm39) missense probably benign 0.43
R5923:Bod1l UTSW 5 41,974,762 (GRCm39) missense probably damaging 1.00
R5991:Bod1l UTSW 5 41,974,206 (GRCm39) nonsense probably null
R6017:Bod1l UTSW 5 41,976,103 (GRCm39) missense probably benign 0.01
R6253:Bod1l UTSW 5 41,983,881 (GRCm39) missense probably damaging 0.96
R6284:Bod1l UTSW 5 41,976,130 (GRCm39) missense probably benign 0.35
R6483:Bod1l UTSW 5 41,978,425 (GRCm39) missense probably benign 0.03
R6485:Bod1l UTSW 5 41,974,459 (GRCm39) missense possibly damaging 0.93
R6575:Bod1l UTSW 5 41,995,411 (GRCm39) missense probably damaging 1.00
R6679:Bod1l UTSW 5 41,974,009 (GRCm39) missense probably damaging 0.97
R6788:Bod1l UTSW 5 41,979,216 (GRCm39) nonsense probably null
R7006:Bod1l UTSW 5 41,989,895 (GRCm39) missense probably damaging 1.00
R7095:Bod1l UTSW 5 41,952,411 (GRCm39) critical splice donor site probably null
R7111:Bod1l UTSW 5 41,970,463 (GRCm39) critical splice donor site probably null
R7190:Bod1l UTSW 5 41,977,281 (GRCm39) missense probably benign 0.14
R7311:Bod1l UTSW 5 41,951,676 (GRCm39) missense possibly damaging 0.57
R7336:Bod1l UTSW 5 41,978,867 (GRCm39) missense probably damaging 1.00
R7341:Bod1l UTSW 5 41,946,200 (GRCm39) missense probably benign 0.00
R7396:Bod1l UTSW 5 41,988,889 (GRCm39) missense probably damaging 1.00
R7431:Bod1l UTSW 5 41,970,463 (GRCm39) critical splice donor site probably null
R7442:Bod1l UTSW 5 41,964,522 (GRCm39) missense probably damaging 0.96
R7539:Bod1l UTSW 5 41,975,203 (GRCm39) missense possibly damaging 0.65
R7583:Bod1l UTSW 5 41,991,133 (GRCm39) missense probably damaging 1.00
R7679:Bod1l UTSW 5 41,977,986 (GRCm39) frame shift probably null
R7748:Bod1l UTSW 5 41,989,683 (GRCm39) missense probably damaging 0.97
R7767:Bod1l UTSW 5 41,974,099 (GRCm39) missense probably benign 0.01
R7773:Bod1l UTSW 5 41,990,055 (GRCm39) missense probably benign 0.14
R7782:Bod1l UTSW 5 41,975,286 (GRCm39) missense probably benign 0.01
R7860:Bod1l UTSW 5 41,976,608 (GRCm39) missense probably damaging 1.00
R7975:Bod1l UTSW 5 41,973,620 (GRCm39) missense possibly damaging 0.90
R7977:Bod1l UTSW 5 41,952,413 (GRCm39) missense probably damaging 1.00
R7987:Bod1l UTSW 5 41,952,413 (GRCm39) missense probably damaging 1.00
R8217:Bod1l UTSW 5 41,988,850 (GRCm39) missense probably damaging 1.00
R8307:Bod1l UTSW 5 41,978,498 (GRCm39) missense probably damaging 1.00
R8469:Bod1l UTSW 5 41,978,834 (GRCm39) missense possibly damaging 0.86
R8506:Bod1l UTSW 5 41,976,398 (GRCm39) nonsense probably null
R8934:Bod1l UTSW 5 41,976,944 (GRCm39) missense probably benign 0.11
R8984:Bod1l UTSW 5 41,946,215 (GRCm39) missense probably damaging 1.00
R8989:Bod1l UTSW 5 41,979,025 (GRCm39) missense probably benign 0.00
R8993:Bod1l UTSW 5 41,974,210 (GRCm39) missense probably benign 0.01
R9128:Bod1l UTSW 5 41,946,266 (GRCm39) missense probably benign 0.22
R9129:Bod1l UTSW 5 41,976,220 (GRCm39) missense probably damaging 0.99
R9198:Bod1l UTSW 5 41,957,129 (GRCm39) missense probably benign 0.08
R9254:Bod1l UTSW 5 41,979,223 (GRCm39) missense probably damaging 1.00
R9445:Bod1l UTSW 5 41,974,619 (GRCm39) missense probably benign 0.04
R9457:Bod1l UTSW 5 41,979,310 (GRCm39) missense probably damaging 0.99
R9470:Bod1l UTSW 5 41,974,439 (GRCm39) missense probably damaging 0.99
R9536:Bod1l UTSW 5 41,974,305 (GRCm39) missense probably benign 0.01
R9654:Bod1l UTSW 5 41,975,707 (GRCm39) missense probably benign 0.02
R9734:Bod1l UTSW 5 41,962,573 (GRCm39) missense possibly damaging 0.91
R9771:Bod1l UTSW 5 41,949,206 (GRCm39) missense probably damaging 0.96
X0027:Bod1l UTSW 5 41,990,012 (GRCm39) missense probably benign 0.20
X0058:Bod1l UTSW 5 41,981,361 (GRCm39) missense probably damaging 1.00
Z1088:Bod1l UTSW 5 41,966,107 (GRCm39) missense possibly damaging 0.95
Z1088:Bod1l UTSW 5 41,978,489 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAACTTGAGCAATATTGAAAGCAC -3'
(R):5'- TCTACCAGCAATGCATTGGGG -3'

Sequencing Primer
(F):5'- ATCCAGGCAGTCAGAACA -3'
(R):5'- CATTGGGGGACAGTTTACAAATGTC -3'
Posted On 2020-06-30