Mutagenetix > Incidental Mutation

Incidental Mutation 'R8104:Bod1l'

630634

Institutional Source

Beutler Lab

Gene Symbol

Bod1l

Ensembl Gene

ENSMUSG00000061755

Gene Name

biorientation of chromosomes in cell division 1-like

Synonyms

A230054D04Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.955) question?

Stock #

R8104 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

41787538-41844315 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 41833732 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 160 (L160*)

Ref Sequence

ENSEMBL: ENSMUSP00000058618 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050556] [ENSMUST00000202908]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000050556
AA Change: L160*

SMART Domains

Protein: ENSMUSP00000058618
Gene: ENSMUSG00000061755
AA Change: L160*

Domain	Start	End	E-Value	Type
low complexity region	5	47	N/A	INTRINSIC
Pfam:COMPASS-Shg1	54	150	1.8e-28	PFAM
low complexity region	328	343	N/A	INTRINSIC
low complexity region	415	435	N/A	INTRINSIC
low complexity region	475	484	N/A	INTRINSIC
coiled coil region	495	520	N/A	INTRINSIC
coiled coil region	553	580	N/A	INTRINSIC
low complexity region	820	840	N/A	INTRINSIC
low complexity region	895	916	N/A	INTRINSIC
low complexity region	996	1005	N/A	INTRINSIC
low complexity region	1023	1041	N/A	INTRINSIC
low complexity region	1272	1286	N/A	INTRINSIC
low complexity region	1791	1809	N/A	INTRINSIC
low complexity region	2695	2701	N/A	INTRINSIC
low complexity region	2711	2729	N/A	INTRINSIC
AT_hook	2807	2819	3.21e-1	SMART
coiled coil region	2908	2929	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000202908
AA Change: L160*

SMART Domains

Protein: ENSMUSP00000144359
Gene: ENSMUSG00000061755
AA Change: L160*

Domain	Start	End	E-Value	Type
low complexity region	5	47	N/A	INTRINSIC
Pfam:COMPASS-Shg1	54	150	2.9e-24	PFAM
low complexity region	328	343	N/A	INTRINSIC
low complexity region	415	435	N/A	INTRINSIC
low complexity region	475	484	N/A	INTRINSIC
coiled coil region	495	520	N/A	INTRINSIC
coiled coil region	553	580	N/A	INTRINSIC
low complexity region	820	840	N/A	INTRINSIC
low complexity region	895	916	N/A	INTRINSIC
low complexity region	996	1005	N/A	INTRINSIC
low complexity region	1023	1041	N/A	INTRINSIC
low complexity region	1272	1286	N/A	INTRINSIC
low complexity region	1791	1809	N/A	INTRINSIC
low complexity region	2695	2701	N/A	INTRINSIC
low complexity region	2711	2729	N/A	INTRINSIC
AT_hook	2807	2819	1.9e-3	SMART
coiled coil region	2908	2929	N/A	INTRINSIC

Coding Region Coverage

1x: 99.8%
3x: 99.5%
10x: 98.6%
20x: 94.6%

Validation Efficiency

98% (54/55)

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsbg2	C	A	17: 56,845,443	L666F	probably benign	Het
Adgrv1	A	T	13: 81,440,225	V4414E	possibly damaging	Het
Apoc3	T	G	9: 46,233,287	D79A	probably damaging	Het
Arfgap1	T	A	2: 180,979,229		probably null	Het
Ascc1	T	C	10: 60,007,729	S38P	probably benign	Het
Asl	C	T	5: 130,011,950	E389K	probably benign	Het
Atat1	A	T	17: 35,904,116	I215K	probably benign	Het
BC067074	T	A	13: 113,319,729	F770I		Het
Cbl	C	A	9: 44,158,539	S637I	possibly damaging	Het
Ccdc112	A	C	18: 46,287,653	S343R	probably benign	Het
Cr1l	A	G	1: 195,117,617	S250P	possibly damaging	Het
Dlgap3	A	G	4: 127,236,154	E907G	probably damaging	Het
Dsp	A	T	13: 38,168,624	E159D	probably benign	Het
Ech1	G	A	7: 28,825,303		probably benign	Het
Erbin	G	T	13: 103,834,977	N710K	possibly damaging	Het
Fbxw28	A	T	9: 109,326,289		probably null	Het
Gm4871	G	C	5: 145,032,202	D100E	probably damaging	Het
Got1l1	A	G	8: 27,197,591	I388T	probably damaging	Het
Ing5	T	A	1: 93,816,444	N184K	probably damaging	Het
Izumo3	A	T	4: 92,146,908	L24*	probably null	Het
Lig1	T	C	7: 13,286,565	V99A	possibly damaging	Het
Mbtps1	A	G	8: 119,529,055	Y488H	possibly damaging	Het
Muc5ac	A	G	7: 141,804,783	Y1240C	possibly damaging	Het
Nav3	T	C	10: 109,758,967	T1458A	probably damaging	Het
Nedd1	T	C	10: 92,691,916	E472G	probably damaging	Het
Nod2	A	T	8: 88,665,057	H664L	possibly damaging	Het
Ntrk3	A	G	7: 78,577,702	S28P	probably damaging	Het
Olfr1357	C	T	10: 78,612,408	V78I	probably benign	Het
Olfr298	A	G	7: 86,489,023	F176S	probably damaging	Het
Olfr699	C	A	7: 106,791,130		probably benign	Het
Olfr699	T	A	7: 106,791,131		probably benign	Het
Olfr792	T	A	10: 129,540,957	M140K	probably benign	Het
Pcdha4	G	T	18: 36,954,053	G430W	probably damaging	Het
Pcnx	T	A	12: 81,983,611	Y1114*	probably null	Het
Pde6a	T	A	18: 61,231,494	D207E	probably damaging	Het
Plekhg1	T	A	10: 3,952,326	I540N		Het
Pnp2	A	T	14: 50,959,642	I62F	probably benign	Het
Rarg	C	A	15: 102,239,899	D258Y	probably damaging	Het
Rnps1	T	A	17: 24,424,510	M262K	unknown	Het
Scaf11	T	C	15: 96,418,602	D1027G	probably benign	Het
Serpina3a	A	T	12: 104,112,851		probably benign	Het
Slc25a1	A	G	16: 17,926,433		probably null	Het
Slc44a3	A	C	3: 121,497,872	V365G	probably benign	Het
Slc45a3	T	C	1: 131,977,016	F26L	probably benign	Het
Slc9a2	T	A	1: 40,718,649	I116K	probably damaging	Het
Stk36	T	A	1: 74,626,597	S700T	probably benign	Het
Tekt3	A	G	11: 63,078,119	D224G	probably benign	Het
Tgtp1	A	T	11: 48,987,014	I288N	probably damaging	Het
Ttn	C	T	2: 76,880,223	V8485M	unknown	Het
Tubg1	G	T	11: 101,124,028	A199S	probably benign	Het
Uso1	T	A	5: 92,158,421	I79K	probably damaging	Het
Utp20	C	T	10: 88,757,904	D2215N	probably damaging	Het
Wdr43	C	T	17: 71,616,355	A32V	probably benign	Het
Zfp704	T	C	3: 9,565,241	D170G	probably benign	Het

Other mutations in Bod1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00944:Bod1l	APN	5	41816823	missense	probably benign	0.00
IGL00990:Bod1l	APN	5	41828865	missense	probably benign	0.00
IGL01021:Bod1l	APN	5	41838173	splice site	probably benign
IGL01022:Bod1l	APN	5	41794309	missense	probably damaging	1.00
IGL01303:Bod1l	APN	5	41817599	missense	probably benign	0.00
IGL01654:Bod1l	APN	5	41818176	missense	probably damaging	0.99
IGL01748:Bod1l	APN	5	41816961	missense	probably benign	0.23
IGL01758:Bod1l	APN	5	41826610	splice site	probably benign
IGL01783:Bod1l	APN	5	41808712	missense	probably benign	0.02
IGL01790:Bod1l	APN	5	41832250	missense	probably benign	0.14
IGL01803:Bod1l	APN	5	41817389	missense	probably damaging	0.97
IGL01829:Bod1l	APN	5	41820468	missense	probably benign	0.25
IGL01952:Bod1l	APN	5	41816954	missense	possibly damaging	0.70
IGL02005:Bod1l	APN	5	41816339	missense	probably benign	0.01
IGL02110:Bod1l	APN	5	41816453	missense	probably damaging	0.97
IGL02129:Bod1l	APN	5	41821850	missense	probably benign	0.36
IGL02572:Bod1l	APN	5	41821230	nonsense	probably null
IGL02583:Bod1l	APN	5	41816207	critical splice donor site	probably null
IGL02643:Bod1l	APN	5	41818805	missense	possibly damaging	0.65
IGL02714:Bod1l	APN	5	41816339	missense	probably benign	0.01
IGL02728:Bod1l	APN	5	41826503	missense	probably damaging	1.00
IGL02752:Bod1l	APN	5	41816463	missense	possibly damaging	0.58
IGL02822:Bod1l	APN	5	41794345	missense	possibly damaging	0.94
IGL03032:Bod1l	APN	5	41831584	missense	probably benign	0.16
IGL03372:Bod1l	APN	5	41805235	splice site	probably benign
capacitance	UTSW	5	41791813	missense	possibly damaging	0.91
gauss	UTSW	5	41816867	missense	probably benign	0.01
Tesla	UTSW	5	41795068	critical splice donor site	probably null
R0102:Bod1l	UTSW	5	41817269	missense	probably benign	0.36
R0147:Bod1l	UTSW	5	41818697	missense	possibly damaging	0.48
R0148:Bod1l	UTSW	5	41818697	missense	possibly damaging	0.48
R0490:Bod1l	UTSW	5	41821892	missense	probably damaging	0.96
R0577:Bod1l	UTSW	5	41794887	missense	probably damaging	1.00
R0587:Bod1l	UTSW	5	41821637	missense	probably benign	0.16
R0620:Bod1l	UTSW	5	41801233	missense	probably benign	0.16
R0626:Bod1l	UTSW	5	41831537	missense	probably damaging	1.00
R0785:Bod1l	UTSW	5	41820016	missense	probably benign	0.00
R1139:Bod1l	UTSW	5	41831471	missense	possibly damaging	0.64
R1165:Bod1l	UTSW	5	41821053	missense	probably benign	0.02
R1418:Bod1l	UTSW	5	41819471	missense	probably damaging	1.00
R1509:Bod1l	UTSW	5	41819540	missense	probably damaging	0.99
R1533:Bod1l	UTSW	5	41822155	nonsense	probably null
R1538:Bod1l	UTSW	5	41816429	missense	probably benign	0.00
R1591:Bod1l	UTSW	5	41819220	missense	probably benign	0.06
R1616:Bod1l	UTSW	5	41808715	missense	probably benign
R1628:Bod1l	UTSW	5	41816982	missense	probably benign	0.01
R1667:Bod1l	UTSW	5	41816775	missense	probably benign	0.01
R1869:Bod1l	UTSW	5	41833675	missense	possibly damaging	0.93
R1870:Bod1l	UTSW	5	41833675	missense	possibly damaging	0.93
R1993:Bod1l	UTSW	5	41817336	missense	probably damaging	1.00
R2060:Bod1l	UTSW	5	41808742	missense	possibly damaging	0.58
R2066:Bod1l	UTSW	5	41805156	missense	probably damaging	0.99
R2067:Bod1l	UTSW	5	41817086	missense	probably benign	0.11
R2073:Bod1l	UTSW	5	41819189	missense	probably benign	0.19
R2092:Bod1l	UTSW	5	41831517	missense	probably damaging	1.00
R2105:Bod1l	UTSW	5	41832279	missense	probably benign	0.00
R2243:Bod1l	UTSW	5	41821545	missense	possibly damaging	0.58
R2322:Bod1l	UTSW	5	41827120	missense	probably benign	0.09
R2849:Bod1l	UTSW	5	41838076	missense	probably damaging	1.00
R2883:Bod1l	UTSW	5	41832259	missense	probably benign	0.03
R3037:Bod1l	UTSW	5	41822037	missense	probably damaging	0.99
R3910:Bod1l	UTSW	5	41817098	missense	probably damaging	0.99
R3911:Bod1l	UTSW	5	41817098	missense	probably damaging	0.99
R3962:Bod1l	UTSW	5	41808721	missense	probably benign	0.07
R4235:Bod1l	UTSW	5	41821455	missense	probably damaging	1.00
R4308:Bod1l	UTSW	5	41791813	missense	possibly damaging	0.91
R4414:Bod1l	UTSW	5	41820527	missense	probably benign	0.04
R4535:Bod1l	UTSW	5	41832231	missense	probably benign	0.06
R4631:Bod1l	UTSW	5	41817735	missense	probably damaging	1.00
R4657:Bod1l	UTSW	5	41818612	missense	probably benign	0.00
R4782:Bod1l	UTSW	5	41833663	missense	probably benign	0.06
R4786:Bod1l	UTSW	5	41819438	missense	probably benign	0.43
R4840:Bod1l	UTSW	5	41818472	missense	probably damaging	1.00
R4877:Bod1l	UTSW	5	41819994	missense	probably benign	0.00
R4982:Bod1l	UTSW	5	41820473	missense	probably benign	0.00
R5152:Bod1l	UTSW	5	41816543	missense	probably benign	0.04
R5284:Bod1l	UTSW	5	41820467	missense	probably benign	0.05
R5354:Bod1l	UTSW	5	41831537	missense	probably damaging	1.00
R5369:Bod1l	UTSW	5	41827183	missense	probably damaging	1.00
R5486:Bod1l	UTSW	5	41807181	missense	possibly damaging	0.56
R5541:Bod1l	UTSW	5	41791933	missense	probably benign	0.06
R5610:Bod1l	UTSW	5	41821874	missense	probably damaging	1.00
R5655:Bod1l	UTSW	5	41817044	missense	probably benign	0.06
R5705:Bod1l	UTSW	5	41817002	missense	probably benign	0.01
R5819:Bod1l	UTSW	5	41832605	missense	probably benign	0.27
R5890:Bod1l	UTSW	5	41820578	missense	probably benign	0.43
R5923:Bod1l	UTSW	5	41817419	missense	probably damaging	1.00
R5991:Bod1l	UTSW	5	41816863	nonsense	probably null
R6017:Bod1l	UTSW	5	41818760	missense	probably benign	0.01
R6253:Bod1l	UTSW	5	41826538	missense	probably damaging	0.96
R6284:Bod1l	UTSW	5	41818787	missense	probably benign	0.35
R6483:Bod1l	UTSW	5	41821082	missense	probably benign	0.03
R6485:Bod1l	UTSW	5	41817116	missense	possibly damaging	0.93
R6575:Bod1l	UTSW	5	41838068	missense	probably damaging	1.00
R6679:Bod1l	UTSW	5	41816666	missense	probably damaging	0.97
R6788:Bod1l	UTSW	5	41821873	nonsense	probably null
R7006:Bod1l	UTSW	5	41832552	missense	probably damaging	1.00
R7095:Bod1l	UTSW	5	41795068	critical splice donor site	probably null
R7111:Bod1l	UTSW	5	41813120	critical splice donor site	probably null
R7190:Bod1l	UTSW	5	41819938	missense	probably benign	0.14
R7311:Bod1l	UTSW	5	41794333	missense	possibly damaging	0.57
R7336:Bod1l	UTSW	5	41821524	missense	probably damaging	1.00
R7341:Bod1l	UTSW	5	41788857	missense	probably benign	0.00
R7396:Bod1l	UTSW	5	41831546	missense	probably damaging	1.00
R7431:Bod1l	UTSW	5	41813120	critical splice donor site	probably null
R7442:Bod1l	UTSW	5	41807179	missense	probably damaging	0.96
R7539:Bod1l	UTSW	5	41817860	missense	possibly damaging	0.65
R7583:Bod1l	UTSW	5	41833790	missense	probably damaging	1.00
R7679:Bod1l	UTSW	5	41820643	frame shift	probably null
R7748:Bod1l	UTSW	5	41832340	missense	probably damaging	0.97
R7767:Bod1l	UTSW	5	41816756	missense	probably benign	0.01
R7773:Bod1l	UTSW	5	41832712	missense	probably benign	0.14
R7782:Bod1l	UTSW	5	41817943	missense	probably benign	0.01
R7860:Bod1l	UTSW	5	41819265	missense	probably damaging	1.00
R7975:Bod1l	UTSW	5	41816277	missense	possibly damaging	0.90
R7977:Bod1l	UTSW	5	41795070	missense	probably damaging	1.00
R7987:Bod1l	UTSW	5	41795070	missense	probably damaging	1.00
R8217:Bod1l	UTSW	5	41831507	missense	probably damaging	1.00
R8307:Bod1l	UTSW	5	41821155	missense	probably damaging	1.00
R8469:Bod1l	UTSW	5	41821491	missense	possibly damaging	0.86
R8506:Bod1l	UTSW	5	41819055	nonsense	probably null
R8934:Bod1l	UTSW	5	41819601	missense	probably benign	0.11
R8984:Bod1l	UTSW	5	41788872	missense	probably damaging	1.00
R8989:Bod1l	UTSW	5	41821682	missense	probably benign	0.00
R8993:Bod1l	UTSW	5	41816867	missense	probably benign	0.01
R9128:Bod1l	UTSW	5	41788923	missense	probably benign	0.22
R9129:Bod1l	UTSW	5	41818877	missense	probably damaging	0.99
R9198:Bod1l	UTSW	5	41799786	missense	probably benign	0.08
R9254:Bod1l	UTSW	5	41821880	missense	probably damaging	1.00
R9445:Bod1l	UTSW	5	41817276	missense	probably benign	0.04
R9457:Bod1l	UTSW	5	41821967	missense	probably damaging	0.99
R9470:Bod1l	UTSW	5	41817096	missense	probably damaging	0.99
R9536:Bod1l	UTSW	5	41816962	missense	probably benign	0.01
R9654:Bod1l	UTSW	5	41818364	missense	probably benign	0.02
R9734:Bod1l	UTSW	5	41805230	missense	possibly damaging	0.91
R9771:Bod1l	UTSW	5	41791863	missense	probably damaging	0.96
X0027:Bod1l	UTSW	5	41832669	missense	probably benign	0.20
X0058:Bod1l	UTSW	5	41824018	missense	probably damaging	1.00
Z1088:Bod1l	UTSW	5	41808764	missense	possibly damaging	0.95
Z1088:Bod1l	UTSW	5	41821146	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAACTTGAGCAATATTGAAAGCAC -3'
(R):5'- TCTACCAGCAATGCATTGGGG -3'

Sequencing Primer
(F):5'- ATCCAGGCAGTCAGAACA -3'
(R):5'- CATTGGGGGACAGTTTACAAATGTC -3'

Posted On

2020-06-30