Incidental Mutation 'R8104:Bod1l'
ID630634
Institutional Source Beutler Lab
Gene Symbol Bod1l
Ensembl Gene ENSMUSG00000061755
Gene Namebiorientation of chromosomes in cell division 1-like
SynonymsA230054D04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #R8104 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location41787538-41844315 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 41833732 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 160 (L160*)
Ref Sequence ENSEMBL: ENSMUSP00000058618 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050556] [ENSMUST00000202908]
Predicted Effect probably null
Transcript: ENSMUST00000050556
AA Change: L160*
SMART Domains Protein: ENSMUSP00000058618
Gene: ENSMUSG00000061755
AA Change: L160*

DomainStartEndE-ValueType
low complexity region 5 47 N/A INTRINSIC
Pfam:COMPASS-Shg1 54 150 1.8e-28 PFAM
low complexity region 328 343 N/A INTRINSIC
low complexity region 415 435 N/A INTRINSIC
low complexity region 475 484 N/A INTRINSIC
coiled coil region 495 520 N/A INTRINSIC
coiled coil region 553 580 N/A INTRINSIC
low complexity region 820 840 N/A INTRINSIC
low complexity region 895 916 N/A INTRINSIC
low complexity region 996 1005 N/A INTRINSIC
low complexity region 1023 1041 N/A INTRINSIC
low complexity region 1272 1286 N/A INTRINSIC
low complexity region 1791 1809 N/A INTRINSIC
low complexity region 2695 2701 N/A INTRINSIC
low complexity region 2711 2729 N/A INTRINSIC
AT_hook 2807 2819 3.21e-1 SMART
coiled coil region 2908 2929 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000202908
AA Change: L160*
SMART Domains Protein: ENSMUSP00000144359
Gene: ENSMUSG00000061755
AA Change: L160*

DomainStartEndE-ValueType
low complexity region 5 47 N/A INTRINSIC
Pfam:COMPASS-Shg1 54 150 2.9e-24 PFAM
low complexity region 328 343 N/A INTRINSIC
low complexity region 415 435 N/A INTRINSIC
low complexity region 475 484 N/A INTRINSIC
coiled coil region 495 520 N/A INTRINSIC
coiled coil region 553 580 N/A INTRINSIC
low complexity region 820 840 N/A INTRINSIC
low complexity region 895 916 N/A INTRINSIC
low complexity region 996 1005 N/A INTRINSIC
low complexity region 1023 1041 N/A INTRINSIC
low complexity region 1272 1286 N/A INTRINSIC
low complexity region 1791 1809 N/A INTRINSIC
low complexity region 2695 2701 N/A INTRINSIC
low complexity region 2711 2729 N/A INTRINSIC
AT_hook 2807 2819 1.9e-3 SMART
coiled coil region 2908 2929 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.6%
  • 20x: 94.6%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg2 C A 17: 56,845,443 L666F probably benign Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Apoc3 T G 9: 46,233,287 D79A probably damaging Het
Arfgap1 T A 2: 180,979,229 probably null Het
Ascc1 T C 10: 60,007,729 S38P probably benign Het
Asl C T 5: 130,011,950 E389K probably benign Het
Atat1 A T 17: 35,904,116 I215K probably benign Het
BC067074 T A 13: 113,319,729 F770I Het
Cbl C A 9: 44,158,539 S637I possibly damaging Het
Ccdc112 A C 18: 46,287,653 S343R probably benign Het
Cr1l A G 1: 195,117,617 S250P possibly damaging Het
Dlgap3 A G 4: 127,236,154 E907G probably damaging Het
Dsp A T 13: 38,168,624 E159D probably benign Het
Ech1 G A 7: 28,825,303 probably benign Het
Erbin G T 13: 103,834,977 N710K possibly damaging Het
Fbxw28 A T 9: 109,326,289 probably null Het
Gm4871 G C 5: 145,032,202 D100E probably damaging Het
Got1l1 A G 8: 27,197,591 I388T probably damaging Het
Ing5 T A 1: 93,816,444 N184K probably damaging Het
Izumo3 A T 4: 92,146,908 L24* probably null Het
Lig1 T C 7: 13,286,565 V99A possibly damaging Het
Mbtps1 A G 8: 119,529,055 Y488H possibly damaging Het
Muc5ac A G 7: 141,804,783 Y1240C possibly damaging Het
Nav3 T C 10: 109,758,967 T1458A probably damaging Het
Nedd1 T C 10: 92,691,916 E472G probably damaging Het
Nod2 A T 8: 88,665,057 H664L possibly damaging Het
Ntrk3 A G 7: 78,577,702 S28P probably damaging Het
Olfr1357 C T 10: 78,612,408 V78I probably benign Het
Olfr298 A G 7: 86,489,023 F176S probably damaging Het
Olfr699 C A 7: 106,791,130 probably benign Het
Olfr699 T A 7: 106,791,131 probably benign Het
Olfr792 T A 10: 129,540,957 M140K probably benign Het
Pcdha4 G T 18: 36,954,053 G430W probably damaging Het
Pcnx T A 12: 81,983,611 Y1114* probably null Het
Pde6a T A 18: 61,231,494 D207E probably damaging Het
Plekhg1 T A 10: 3,952,326 I540N Het
Pnp2 A T 14: 50,959,642 I62F probably benign Het
Rarg C A 15: 102,239,899 D258Y probably damaging Het
Rnps1 T A 17: 24,424,510 M262K unknown Het
Scaf11 T C 15: 96,418,602 D1027G probably benign Het
Serpina3a A T 12: 104,112,851 probably benign Het
Slc25a1 A G 16: 17,926,433 probably null Het
Slc44a3 A C 3: 121,497,872 V365G probably benign Het
Slc45a3 T C 1: 131,977,016 F26L probably benign Het
Slc9a2 T A 1: 40,718,649 I116K probably damaging Het
Stk36 T A 1: 74,626,597 S700T probably benign Het
Tekt3 A G 11: 63,078,119 D224G probably benign Het
Tgtp1 A T 11: 48,987,014 I288N probably damaging Het
Ttn C T 2: 76,880,223 V8485M unknown Het
Tubg1 G T 11: 101,124,028 A199S probably benign Het
Uso1 T A 5: 92,158,421 I79K probably damaging Het
Utp20 C T 10: 88,757,904 D2215N probably damaging Het
Wdr43 C T 17: 71,616,355 A32V probably benign Het
Zfp704 T C 3: 9,565,241 D170G probably benign Het
Other mutations in Bod1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Bod1l APN 5 41816823 missense probably benign 0.00
IGL00990:Bod1l APN 5 41828865 missense probably benign 0.00
IGL01021:Bod1l APN 5 41838173 splice site probably benign
IGL01022:Bod1l APN 5 41794309 missense probably damaging 1.00
IGL01303:Bod1l APN 5 41817599 missense probably benign 0.00
IGL01654:Bod1l APN 5 41818176 missense probably damaging 0.99
IGL01748:Bod1l APN 5 41816961 missense probably benign 0.23
IGL01758:Bod1l APN 5 41826610 splice site probably benign
IGL01783:Bod1l APN 5 41808712 missense probably benign 0.02
IGL01790:Bod1l APN 5 41832250 missense probably benign 0.14
IGL01803:Bod1l APN 5 41817389 missense probably damaging 0.97
IGL01829:Bod1l APN 5 41820468 missense probably benign 0.25
IGL01952:Bod1l APN 5 41816954 missense possibly damaging 0.70
IGL02005:Bod1l APN 5 41816339 missense probably benign 0.01
IGL02110:Bod1l APN 5 41816453 missense probably damaging 0.97
IGL02129:Bod1l APN 5 41821850 missense probably benign 0.36
IGL02572:Bod1l APN 5 41821230 nonsense probably null
IGL02583:Bod1l APN 5 41816207 critical splice donor site probably null
IGL02643:Bod1l APN 5 41818805 missense possibly damaging 0.65
IGL02714:Bod1l APN 5 41816339 missense probably benign 0.01
IGL02728:Bod1l APN 5 41826503 missense probably damaging 1.00
IGL02752:Bod1l APN 5 41816463 missense possibly damaging 0.58
IGL02822:Bod1l APN 5 41794345 missense possibly damaging 0.94
IGL03032:Bod1l APN 5 41831584 missense probably benign 0.16
IGL03372:Bod1l APN 5 41805235 splice site probably benign
R0102:Bod1l UTSW 5 41817269 missense probably benign 0.36
R0147:Bod1l UTSW 5 41818697 missense possibly damaging 0.48
R0148:Bod1l UTSW 5 41818697 missense possibly damaging 0.48
R0490:Bod1l UTSW 5 41821892 missense probably damaging 0.96
R0577:Bod1l UTSW 5 41794887 missense probably damaging 1.00
R0587:Bod1l UTSW 5 41821637 missense probably benign 0.16
R0620:Bod1l UTSW 5 41801233 missense probably benign 0.16
R0626:Bod1l UTSW 5 41831537 missense probably damaging 1.00
R0785:Bod1l UTSW 5 41820016 missense probably benign 0.00
R1139:Bod1l UTSW 5 41831471 missense possibly damaging 0.64
R1165:Bod1l UTSW 5 41821053 missense probably benign 0.02
R1418:Bod1l UTSW 5 41819471 missense probably damaging 1.00
R1509:Bod1l UTSW 5 41819540 missense probably damaging 0.99
R1533:Bod1l UTSW 5 41822155 nonsense probably null
R1538:Bod1l UTSW 5 41816429 missense probably benign 0.00
R1591:Bod1l UTSW 5 41819220 missense probably benign 0.06
R1616:Bod1l UTSW 5 41808715 missense probably benign
R1628:Bod1l UTSW 5 41816982 missense probably benign 0.01
R1667:Bod1l UTSW 5 41816775 missense probably benign 0.01
R1869:Bod1l UTSW 5 41833675 missense possibly damaging 0.93
R1870:Bod1l UTSW 5 41833675 missense possibly damaging 0.93
R1993:Bod1l UTSW 5 41817336 missense probably damaging 1.00
R2060:Bod1l UTSW 5 41808742 missense possibly damaging 0.58
R2066:Bod1l UTSW 5 41805156 missense probably damaging 0.99
R2067:Bod1l UTSW 5 41817086 missense probably benign 0.11
R2073:Bod1l UTSW 5 41819189 missense probably benign 0.19
R2092:Bod1l UTSW 5 41831517 missense probably damaging 1.00
R2105:Bod1l UTSW 5 41832279 missense probably benign 0.00
R2243:Bod1l UTSW 5 41821545 missense possibly damaging 0.58
R2322:Bod1l UTSW 5 41827120 missense probably benign 0.09
R2849:Bod1l UTSW 5 41838076 missense probably damaging 1.00
R2883:Bod1l UTSW 5 41832259 missense probably benign 0.03
R3037:Bod1l UTSW 5 41822037 missense probably damaging 0.99
R3910:Bod1l UTSW 5 41817098 missense probably damaging 0.99
R3911:Bod1l UTSW 5 41817098 missense probably damaging 0.99
R3962:Bod1l UTSW 5 41808721 missense probably benign 0.07
R4235:Bod1l UTSW 5 41821455 missense probably damaging 1.00
R4308:Bod1l UTSW 5 41791813 missense possibly damaging 0.91
R4414:Bod1l UTSW 5 41820527 missense probably benign 0.04
R4535:Bod1l UTSW 5 41832231 missense probably benign 0.06
R4631:Bod1l UTSW 5 41817735 missense probably damaging 1.00
R4657:Bod1l UTSW 5 41818612 missense probably benign 0.00
R4782:Bod1l UTSW 5 41833663 missense probably benign 0.06
R4786:Bod1l UTSW 5 41819438 missense probably benign 0.43
R4840:Bod1l UTSW 5 41818472 missense probably damaging 1.00
R4877:Bod1l UTSW 5 41819994 missense probably benign 0.00
R4982:Bod1l UTSW 5 41820473 missense probably benign 0.00
R5152:Bod1l UTSW 5 41816543 missense probably benign 0.04
R5284:Bod1l UTSW 5 41820467 missense probably benign 0.05
R5354:Bod1l UTSW 5 41831537 missense probably damaging 1.00
R5369:Bod1l UTSW 5 41827183 missense probably damaging 1.00
R5486:Bod1l UTSW 5 41807181 missense possibly damaging 0.56
R5541:Bod1l UTSW 5 41791933 missense probably benign 0.06
R5610:Bod1l UTSW 5 41821874 missense probably damaging 1.00
R5655:Bod1l UTSW 5 41817044 missense probably benign 0.06
R5705:Bod1l UTSW 5 41817002 missense probably benign 0.01
R5819:Bod1l UTSW 5 41832605 missense probably benign 0.27
R5890:Bod1l UTSW 5 41820578 missense probably benign 0.43
R5923:Bod1l UTSW 5 41817419 missense probably damaging 1.00
R5991:Bod1l UTSW 5 41816863 nonsense probably null
R6017:Bod1l UTSW 5 41818760 missense probably benign 0.01
R6253:Bod1l UTSW 5 41826538 missense probably damaging 0.96
R6284:Bod1l UTSW 5 41818787 missense probably benign 0.35
R6483:Bod1l UTSW 5 41821082 missense probably benign 0.03
R6485:Bod1l UTSW 5 41817116 missense possibly damaging 0.93
R6575:Bod1l UTSW 5 41838068 missense probably damaging 1.00
R6679:Bod1l UTSW 5 41816666 missense probably damaging 0.97
R6788:Bod1l UTSW 5 41821873 nonsense probably null
R7006:Bod1l UTSW 5 41832552 missense probably damaging 1.00
R7095:Bod1l UTSW 5 41795068 critical splice donor site probably null
R7111:Bod1l UTSW 5 41813120 critical splice donor site probably null
R7190:Bod1l UTSW 5 41819938 missense probably benign 0.14
R7311:Bod1l UTSW 5 41794333 missense possibly damaging 0.57
R7336:Bod1l UTSW 5 41821524 missense probably damaging 1.00
R7341:Bod1l UTSW 5 41788857 missense probably benign 0.00
R7396:Bod1l UTSW 5 41831546 missense probably damaging 1.00
R7431:Bod1l UTSW 5 41813120 critical splice donor site probably null
R7442:Bod1l UTSW 5 41807179 missense probably damaging 0.96
R7539:Bod1l UTSW 5 41817860 missense possibly damaging 0.65
R7583:Bod1l UTSW 5 41833790 missense probably damaging 1.00
R7679:Bod1l UTSW 5 41820643 frame shift probably null
R7748:Bod1l UTSW 5 41832340 missense probably damaging 0.97
R7767:Bod1l UTSW 5 41816756 missense probably benign 0.01
R7773:Bod1l UTSW 5 41832712 missense probably benign 0.14
R7782:Bod1l UTSW 5 41817943 missense probably benign 0.01
R7860:Bod1l UTSW 5 41819265 missense probably damaging 1.00
R7975:Bod1l UTSW 5 41816277 missense possibly damaging 0.90
R7977:Bod1l UTSW 5 41795070 missense probably damaging 1.00
R7987:Bod1l UTSW 5 41795070 missense probably damaging 1.00
R8217:Bod1l UTSW 5 41831507 missense probably damaging 1.00
R8307:Bod1l UTSW 5 41821155 missense probably damaging 1.00
R8469:Bod1l UTSW 5 41821491 missense possibly damaging 0.86
R8506:Bod1l UTSW 5 41819055 nonsense probably null
R8934:Bod1l UTSW 5 41819601 missense probably benign 0.11
X0027:Bod1l UTSW 5 41832669 missense probably benign 0.20
X0058:Bod1l UTSW 5 41824018 missense probably damaging 1.00
Z1088:Bod1l UTSW 5 41808764 missense possibly damaging 0.95
Z1088:Bod1l UTSW 5 41821146 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAACTTGAGCAATATTGAAAGCAC -3'
(R):5'- TCTACCAGCAATGCATTGGGG -3'

Sequencing Primer
(F):5'- ATCCAGGCAGTCAGAACA -3'
(R):5'- CATTGGGGGACAGTTTACAAATGTC -3'
Posted On2020-06-30