Incidental Mutation 'R8104:Nod2'
ID630646
Institutional Source Beutler Lab
Gene Symbol Nod2
Ensembl Gene ENSMUSG00000055994
Gene Namenucleotide-binding oligomerization domain containing 2
SynonymsNlrc2, Card15, F830032C23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.213) question?
Stock #R8104 (G1)
Quality Score147.008
Status Validated
Chromosome8
Chromosomal Location88647315-88688474 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88665057 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 664 (H664L)
Ref Sequence ENSEMBL: ENSMUSP00000050538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054324] [ENSMUST00000109634] [ENSMUST00000118370]
Predicted Effect possibly damaging
Transcript: ENSMUST00000054324
AA Change: H664L

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000050538
Gene: ENSMUSG00000055994
AA Change: H664L

DomainStartEndE-ValueType
Pfam:CARD 4 92 5.3e-20 PFAM
Blast:CARD 100 177 8e-11 BLAST
Pfam:NACHT 288 458 1.8e-46 PFAM
low complexity region 521 554 N/A INTRINSIC
low complexity region 628 639 N/A INTRINSIC
LRR 781 811 3.15e1 SMART
LRR 813 836 1.12e2 SMART
LRR 837 864 8.53e0 SMART
LRR 865 892 1.58e-3 SMART
LRR 893 920 4.83e-1 SMART
LRR 921 948 1.13e0 SMART
LRR 949 976 4.68e-6 SMART
LRR 977 1004 7.78e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109634
AA Change: H649L

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105262
Gene: ENSMUSG00000055994
AA Change: H649L

DomainStartEndE-ValueType
Pfam:CARD 11 99 2.5e-22 PFAM
Pfam:CARD 111 195 2.1e-14 PFAM
Pfam:NACHT 273 443 1.2e-45 PFAM
low complexity region 506 539 N/A INTRINSIC
low complexity region 613 624 N/A INTRINSIC
LRR 766 796 3.15e1 SMART
LRR 798 821 1.12e2 SMART
LRR 822 849 8.53e0 SMART
LRR 850 877 1.58e-3 SMART
LRR 878 905 4.83e-1 SMART
LRR 906 933 1.13e0 SMART
LRR 934 961 4.68e-6 SMART
LRR 962 989 7.78e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000118370
AA Change: H642L

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113773
Gene: ENSMUSG00000055994
AA Change: H642L

DomainStartEndE-ValueType
Pfam:CARD 4 92 1e-21 PFAM
Pfam:CARD 104 188 8.4e-14 PFAM
Pfam:NACHT 266 436 2.5e-45 PFAM
low complexity region 499 532 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
LRR 759 789 3.15e1 SMART
LRR 791 814 1.12e2 SMART
LRR 815 842 8.53e0 SMART
LRR 843 870 1.58e-3 SMART
LRR 871 898 4.83e-1 SMART
LRR 899 926 1.13e0 SMART
LRR 927 954 4.68e-6 SMART
LRR 955 982 7.78e-3 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.6%
  • 20x: 94.6%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Nod1/Apaf-1 family and encodes a protein with two caspase recruitment (CARD) domains and six leucine-rich repeats (LRRs). The protein is primarily expressed in the peripheral blood leukocytes. It plays a role in the immune response to intracellular bacterial lipopolysaccharides (LPS) by recognizing the muramyl dipeptide (MDP) derived from them and activating the NFKB protein. Mutations in this gene have been associated with Crohn disease and Blau syndrome. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal immune system morphology and physiology and increased susceptibility to induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg2 C A 17: 56,845,443 L666F probably benign Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Apoc3 T G 9: 46,233,287 D79A probably damaging Het
Arfgap1 T A 2: 180,979,229 probably null Het
Ascc1 T C 10: 60,007,729 S38P probably benign Het
Asl C T 5: 130,011,950 E389K probably benign Het
Atat1 A T 17: 35,904,116 I215K probably benign Het
BC067074 T A 13: 113,319,729 F770I Het
Bod1l A T 5: 41,833,732 L160* probably null Het
Cbl C A 9: 44,158,539 S637I possibly damaging Het
Ccdc112 A C 18: 46,287,653 S343R probably benign Het
Cr1l A G 1: 195,117,617 S250P possibly damaging Het
Dlgap3 A G 4: 127,236,154 E907G probably damaging Het
Dsp A T 13: 38,168,624 E159D probably benign Het
Ech1 G A 7: 28,825,303 probably benign Het
Erbin G T 13: 103,834,977 N710K possibly damaging Het
Fbxw28 A T 9: 109,326,289 probably null Het
Gm4871 G C 5: 145,032,202 D100E probably damaging Het
Got1l1 A G 8: 27,197,591 I388T probably damaging Het
Ing5 T A 1: 93,816,444 N184K probably damaging Het
Izumo3 A T 4: 92,146,908 L24* probably null Het
Lig1 T C 7: 13,286,565 V99A possibly damaging Het
Mbtps1 A G 8: 119,529,055 Y488H possibly damaging Het
Muc5ac A G 7: 141,804,783 Y1240C possibly damaging Het
Nav3 T C 10: 109,758,967 T1458A probably damaging Het
Nedd1 T C 10: 92,691,916 E472G probably damaging Het
Ntrk3 A G 7: 78,577,702 S28P probably damaging Het
Olfr1357 C T 10: 78,612,408 V78I probably benign Het
Olfr298 A G 7: 86,489,023 F176S probably damaging Het
Olfr699 C A 7: 106,791,130 probably benign Het
Olfr699 T A 7: 106,791,131 probably benign Het
Olfr792 T A 10: 129,540,957 M140K probably benign Het
Pcdha4 G T 18: 36,954,053 G430W probably damaging Het
Pcnx T A 12: 81,983,611 Y1114* probably null Het
Pde6a T A 18: 61,231,494 D207E probably damaging Het
Plekhg1 T A 10: 3,952,326 I540N Het
Pnp2 A T 14: 50,959,642 I62F probably benign Het
Rarg C A 15: 102,239,899 D258Y probably damaging Het
Rnps1 T A 17: 24,424,510 M262K unknown Het
Scaf11 T C 15: 96,418,602 D1027G probably benign Het
Serpina3a A T 12: 104,112,851 probably benign Het
Slc25a1 A G 16: 17,926,433 probably null Het
Slc44a3 A C 3: 121,497,872 V365G probably benign Het
Slc45a3 T C 1: 131,977,016 F26L probably benign Het
Slc9a2 T A 1: 40,718,649 I116K probably damaging Het
Stk36 T A 1: 74,626,597 S700T probably benign Het
Tekt3 A G 11: 63,078,119 D224G probably benign Het
Tgtp1 A T 11: 48,987,014 I288N probably damaging Het
Ttn C T 2: 76,880,223 V8485M unknown Het
Tubg1 G T 11: 101,124,028 A199S probably benign Het
Uso1 T A 5: 92,158,421 I79K probably damaging Het
Utp20 C T 10: 88,757,904 D2215N probably damaging Het
Wdr43 C T 17: 71,616,355 A32V probably benign Het
Zfp704 T C 3: 9,565,241 D170G probably benign Het
Other mutations in Nod2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01404:Nod2 APN 8 88663736 missense probably benign 0.02
IGL02299:Nod2 APN 8 88663742 missense possibly damaging 0.81
PIT4687001:Nod2 UTSW 8 88681646 missense probably damaging 1.00
R0305:Nod2 UTSW 8 88665323 missense probably damaging 1.00
R0391:Nod2 UTSW 8 88663778 missense probably benign 0.00
R0580:Nod2 UTSW 8 88664406 missense probably damaging 1.00
R0617:Nod2 UTSW 8 88653231 missense probably benign 0.00
R0815:Nod2 UTSW 8 88672662 splice site probably benign
R1460:Nod2 UTSW 8 88663812 missense probably damaging 1.00
R1528:Nod2 UTSW 8 88664589 missense possibly damaging 0.92
R1707:Nod2 UTSW 8 88670476 missense possibly damaging 0.59
R1934:Nod2 UTSW 8 88663719 missense probably benign
R1956:Nod2 UTSW 8 88664208 missense probably damaging 1.00
R1972:Nod2 UTSW 8 88652873 missense probably damaging 1.00
R1973:Nod2 UTSW 8 88652873 missense probably damaging 1.00
R2902:Nod2 UTSW 8 88675463 missense probably damaging 1.00
R2918:Nod2 UTSW 8 88652891 missense probably benign 0.02
R3435:Nod2 UTSW 8 88664009 missense possibly damaging 0.64
R3705:Nod2 UTSW 8 88653320 missense probably benign 0.02
R4395:Nod2 UTSW 8 88664391 missense probably damaging 1.00
R4612:Nod2 UTSW 8 88665036 missense possibly damaging 0.65
R4756:Nod2 UTSW 8 88664274 missense possibly damaging 0.59
R5122:Nod2 UTSW 8 88664120 missense probably damaging 1.00
R5144:Nod2 UTSW 8 88653066 missense probably damaging 0.99
R5166:Nod2 UTSW 8 88664247 missense possibly damaging 0.58
R5203:Nod2 UTSW 8 88664451 missense probably damaging 1.00
R5338:Nod2 UTSW 8 88672785 splice site probably null
R5614:Nod2 UTSW 8 88664196 missense probably damaging 1.00
R5746:Nod2 UTSW 8 88664342 missense probably damaging 0.98
R5834:Nod2 UTSW 8 88664639 missense possibly damaging 0.91
R6059:Nod2 UTSW 8 88664414 missense probably damaging 1.00
R6282:Nod2 UTSW 8 88670460 missense probably benign 0.02
R6707:Nod2 UTSW 8 88665189 missense probably benign
R6741:Nod2 UTSW 8 88653066 missense probably damaging 0.99
R6838:Nod2 UTSW 8 88670458 missense possibly damaging 0.63
R7008:Nod2 UTSW 8 88663657 nonsense probably null
R7182:Nod2 UTSW 8 88663832 missense probably benign 0.01
R7324:Nod2 UTSW 8 88653066 missense probably damaging 1.00
R7344:Nod2 UTSW 8 88660582 missense probably damaging 1.00
R7588:Nod2 UTSW 8 88674908 missense possibly damaging 0.80
R7625:Nod2 UTSW 8 88665278 missense probably damaging 0.98
R7832:Nod2 UTSW 8 88660797 splice site probably null
R8217:Nod2 UTSW 8 88664157 missense probably benign 0.06
Z1088:Nod2 UTSW 8 88664146 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTGGAGTTCCTGCACATTACC -3'
(R):5'- ATGCATGCTCTTGGTCTCAC -3'

Sequencing Primer
(F):5'- GAGTTCCTGCACATTACCTTCCAG -3'
(R):5'- TCTTGGTCTCACCGGGCAC -3'
Posted On2020-06-30