Incidental Mutation 'R8104:Rarg'
ID630668
Institutional Source Beutler Lab
Gene Symbol Rarg
Ensembl Gene ENSMUSG00000001288
Gene Nameretinoic acid receptor, gamma
SynonymsRAR gamma 2, RARgamma2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.797) question?
Stock #R8104 (G1)
Quality Score214.009
Status Validated
Chromosome15
Chromosomal Location102234938-102257517 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 102239899 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 258 (D258Y)
Ref Sequence ENSEMBL: ENSMUSP00000048838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043172] [ENSMUST00000063339] [ENSMUST00000130204] [ENSMUST00000135466] [ENSMUST00000155563]
Predicted Effect probably damaging
Transcript: ENSMUST00000043172
AA Change: D258Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048838
Gene: ENSMUSG00000001288
AA Change: D258Y

DomainStartEndE-ValueType
low complexity region 10 32 N/A INTRINSIC
low complexity region 75 84 N/A INTRINSIC
ZnF_C4 87 158 1.53e-40 SMART
HOLI 232 390 9.07e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000063339
AA Change: D247Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067266
Gene: ENSMUSG00000001288
AA Change: D247Y

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
low complexity region 48 61 N/A INTRINSIC
low complexity region 64 73 N/A INTRINSIC
ZnF_C4 76 147 1.53e-40 SMART
HOLI 221 379 9.07e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130204
Predicted Effect probably benign
Transcript: ENSMUST00000135466
SMART Domains Protein: ENSMUSP00000118615
Gene: ENSMUSG00000001288

DomainStartEndE-ValueType
low complexity region 10 32 N/A INTRINSIC
low complexity region 75 84 N/A INTRINSIC
ZnF_C4 87 158 1.53e-40 SMART
PDB:1EXX|A 178 227 5e-28 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000155563
Meta Mutation Damage Score 0.9751 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.6%
  • 20x: 94.6%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a retinoic acid receptor that belongs to the nuclear hormone receptor family. Retinoic acid receptors (RARs) act as ligand-dependent transcriptional regulators. When bound to ligands, RARs activate transcription by binding as heterodimers to the retinoic acid response elements (RARE) found in the promoter regions of the target genes. In their unbound form, RARs repress transcription of their target genes. RARs are involved in various biological processes, including limb bud development, skeletal growth, and matrix homeostasis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit stunted growth, homeotic transformations of the rostral axial skeleton and tracheal cartilage, Harderian gland agenesis, high postnatal mortality, and male sterility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg2 C A 17: 56,845,443 L666F probably benign Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Apoc3 T G 9: 46,233,287 D79A probably damaging Het
Arfgap1 T A 2: 180,979,229 probably null Het
Ascc1 T C 10: 60,007,729 S38P probably benign Het
Asl C T 5: 130,011,950 E389K probably benign Het
Atat1 A T 17: 35,904,116 I215K probably benign Het
BC067074 T A 13: 113,319,729 F770I Het
Bod1l A T 5: 41,833,732 L160* probably null Het
Cbl C A 9: 44,158,539 S637I possibly damaging Het
Ccdc112 A C 18: 46,287,653 S343R probably benign Het
Cr1l A G 1: 195,117,617 S250P possibly damaging Het
Dlgap3 A G 4: 127,236,154 E907G probably damaging Het
Dsp A T 13: 38,168,624 E159D probably benign Het
Ech1 G A 7: 28,825,303 probably benign Het
Erbin G T 13: 103,834,977 N710K possibly damaging Het
Fbxw28 A T 9: 109,326,289 probably null Het
Gm4871 G C 5: 145,032,202 D100E probably damaging Het
Got1l1 A G 8: 27,197,591 I388T probably damaging Het
Ing5 T A 1: 93,816,444 N184K probably damaging Het
Izumo3 A T 4: 92,146,908 L24* probably null Het
Lig1 T C 7: 13,286,565 V99A possibly damaging Het
Mbtps1 A G 8: 119,529,055 Y488H possibly damaging Het
Muc5ac A G 7: 141,804,783 Y1240C possibly damaging Het
Nav3 T C 10: 109,758,967 T1458A probably damaging Het
Nedd1 T C 10: 92,691,916 E472G probably damaging Het
Nod2 A T 8: 88,665,057 H664L possibly damaging Het
Ntrk3 A G 7: 78,577,702 S28P probably damaging Het
Olfr1357 C T 10: 78,612,408 V78I probably benign Het
Olfr298 A G 7: 86,489,023 F176S probably damaging Het
Olfr699 C A 7: 106,791,130 probably benign Het
Olfr699 T A 7: 106,791,131 probably benign Het
Olfr792 T A 10: 129,540,957 M140K probably benign Het
Pcdha4 G T 18: 36,954,053 G430W probably damaging Het
Pcnx T A 12: 81,983,611 Y1114* probably null Het
Pde6a T A 18: 61,231,494 D207E probably damaging Het
Plekhg1 T A 10: 3,952,326 I540N Het
Pnp2 A T 14: 50,959,642 I62F probably benign Het
Rnps1 T A 17: 24,424,510 M262K unknown Het
Scaf11 T C 15: 96,418,602 D1027G probably benign Het
Serpina3a A T 12: 104,112,851 probably benign Het
Slc25a1 A G 16: 17,926,433 probably null Het
Slc44a3 A C 3: 121,497,872 V365G probably benign Het
Slc45a3 T C 1: 131,977,016 F26L probably benign Het
Slc9a2 T A 1: 40,718,649 I116K probably damaging Het
Stk36 T A 1: 74,626,597 S700T probably benign Het
Tekt3 A G 11: 63,078,119 D224G probably benign Het
Tgtp1 A T 11: 48,987,014 I288N probably damaging Het
Ttn C T 2: 76,880,223 V8485M unknown Het
Tubg1 G T 11: 101,124,028 A199S probably benign Het
Uso1 T A 5: 92,158,421 I79K probably damaging Het
Utp20 C T 10: 88,757,904 D2215N probably damaging Het
Wdr43 C T 17: 71,616,355 A32V probably benign Het
Zfp704 T C 3: 9,565,241 D170G probably benign Het
Other mutations in Rarg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02877:Rarg APN 15 102241939 splice site probably null
R0033:Rarg UTSW 15 102238835 missense probably damaging 0.99
R0539:Rarg UTSW 15 102238877 missense probably damaging 1.00
R1137:Rarg UTSW 15 102241160 missense probably damaging 1.00
R1593:Rarg UTSW 15 102239941 missense probably damaging 1.00
R1916:Rarg UTSW 15 102252445 missense probably benign 0.00
R1926:Rarg UTSW 15 102239545 missense probably damaging 1.00
R2057:Rarg UTSW 15 102239504 missense probably damaging 0.99
R2211:Rarg UTSW 15 102239524 missense probably benign 0.20
R4581:Rarg UTSW 15 102252551 missense possibly damaging 0.70
R5718:Rarg UTSW 15 102241067 missense probably damaging 1.00
R6197:Rarg UTSW 15 102241892 missense possibly damaging 0.94
R6991:Rarg UTSW 15 102241915 missense probably damaging 1.00
R7300:Rarg UTSW 15 102252417 critical splice donor site probably null
R8121:Rarg UTSW 15 102239958 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGACTCTTGAGATTGGAAAG -3'
(R):5'- AGCCCACCAGGAGACTTTTC -3'

Sequencing Primer
(F):5'- CTCTTGAGATTGGAAAGGGGAGGC -3'
(R):5'- AGCTGGGCAAGTACACCACG -3'
Posted On2020-06-30