Incidental Mutation 'R8104:Ccdc112'
ID630675
Institutional Source Beutler Lab
Gene Symbol Ccdc112
Ensembl Gene ENSMUSG00000071855
Gene Namecoiled-coil domain containing 112
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R8104 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location46282151-46311928 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 46287653 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 343 (S343R)
Ref Sequence ENSEMBL: ENSMUSP00000072614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072835]
Predicted Effect probably benign
Transcript: ENSMUST00000072835
AA Change: S343R

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000072614
Gene: ENSMUSG00000071855
AA Change: S343R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
coiled coil region 111 199 N/A INTRINSIC
coiled coil region 300 332 N/A INTRINSIC
low complexity region 345 355 N/A INTRINSIC
coiled coil region 362 483 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.6%
  • 20x: 94.6%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg2 C A 17: 56,845,443 L666F probably benign Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Apoc3 T G 9: 46,233,287 D79A probably damaging Het
Arfgap1 T A 2: 180,979,229 probably null Het
Ascc1 T C 10: 60,007,729 S38P probably benign Het
Asl C T 5: 130,011,950 E389K probably benign Het
Atat1 A T 17: 35,904,116 I215K probably benign Het
BC067074 T A 13: 113,319,729 F770I Het
Bod1l A T 5: 41,833,732 L160* probably null Het
Cbl C A 9: 44,158,539 S637I possibly damaging Het
Cr1l A G 1: 195,117,617 S250P possibly damaging Het
Dlgap3 A G 4: 127,236,154 E907G probably damaging Het
Dsp A T 13: 38,168,624 E159D probably benign Het
Ech1 G A 7: 28,825,303 probably benign Het
Erbin G T 13: 103,834,977 N710K possibly damaging Het
Fbxw28 A T 9: 109,326,289 probably null Het
Gm4871 G C 5: 145,032,202 D100E probably damaging Het
Got1l1 A G 8: 27,197,591 I388T probably damaging Het
Ing5 T A 1: 93,816,444 N184K probably damaging Het
Izumo3 A T 4: 92,146,908 L24* probably null Het
Lig1 T C 7: 13,286,565 V99A possibly damaging Het
Mbtps1 A G 8: 119,529,055 Y488H possibly damaging Het
Muc5ac A G 7: 141,804,783 Y1240C possibly damaging Het
Nav3 T C 10: 109,758,967 T1458A probably damaging Het
Nedd1 T C 10: 92,691,916 E472G probably damaging Het
Nod2 A T 8: 88,665,057 H664L possibly damaging Het
Ntrk3 A G 7: 78,577,702 S28P probably damaging Het
Olfr1357 C T 10: 78,612,408 V78I probably benign Het
Olfr298 A G 7: 86,489,023 F176S probably damaging Het
Olfr699 C A 7: 106,791,130 probably benign Het
Olfr699 T A 7: 106,791,131 probably benign Het
Olfr792 T A 10: 129,540,957 M140K probably benign Het
Pcdha4 G T 18: 36,954,053 G430W probably damaging Het
Pcnx T A 12: 81,983,611 Y1114* probably null Het
Pde6a T A 18: 61,231,494 D207E probably damaging Het
Plekhg1 T A 10: 3,952,326 I540N Het
Pnp2 A T 14: 50,959,642 I62F probably benign Het
Rarg C A 15: 102,239,899 D258Y probably damaging Het
Rnps1 T A 17: 24,424,510 M262K unknown Het
Scaf11 T C 15: 96,418,602 D1027G probably benign Het
Serpina3a A T 12: 104,112,851 probably benign Het
Slc25a1 A G 16: 17,926,433 probably null Het
Slc44a3 A C 3: 121,497,872 V365G probably benign Het
Slc45a3 T C 1: 131,977,016 F26L probably benign Het
Slc9a2 T A 1: 40,718,649 I116K probably damaging Het
Stk36 T A 1: 74,626,597 S700T probably benign Het
Tekt3 A G 11: 63,078,119 D224G probably benign Het
Tgtp1 A T 11: 48,987,014 I288N probably damaging Het
Ttn C T 2: 76,880,223 V8485M unknown Het
Tubg1 G T 11: 101,124,028 A199S probably benign Het
Uso1 T A 5: 92,158,421 I79K probably damaging Het
Utp20 C T 10: 88,757,904 D2215N probably damaging Het
Wdr43 C T 17: 71,616,355 A32V probably benign Het
Zfp704 T C 3: 9,565,241 D170G probably benign Het
Other mutations in Ccdc112
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01455:Ccdc112 APN 18 46293444 missense possibly damaging 0.81
IGL02860:Ccdc112 APN 18 46287442 missense probably benign 0.00
R0546:Ccdc112 UTSW 18 46291072 missense possibly damaging 0.73
R0566:Ccdc112 UTSW 18 46290810 missense probably damaging 0.97
R1815:Ccdc112 UTSW 18 46291106 missense possibly damaging 0.85
R1847:Ccdc112 UTSW 18 46287754 missense possibly damaging 0.80
R1853:Ccdc112 UTSW 18 46285700 missense probably benign 0.07
R2011:Ccdc112 UTSW 18 46287432 missense probably damaging 1.00
R3787:Ccdc112 UTSW 18 46299298 missense probably benign 0.03
R4519:Ccdc112 UTSW 18 46287546 missense possibly damaging 0.94
R4795:Ccdc112 UTSW 18 46287672 missense probably benign 0.20
R4873:Ccdc112 UTSW 18 46296289 missense probably damaging 1.00
R4875:Ccdc112 UTSW 18 46296289 missense probably damaging 1.00
R7208:Ccdc112 UTSW 18 46287631 missense probably damaging 1.00
R7807:Ccdc112 UTSW 18 46290759 missense probably damaging 0.99
R7849:Ccdc112 UTSW 18 46296323 missense probably benign 0.30
R8060:Ccdc112 UTSW 18 46293462 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTCCTGCTCAAGCCTCAG -3'
(R):5'- TGGCTGATCTGATCGTAAGC -3'

Sequencing Primer
(F):5'- GCTCAAGCCTCAGGAACTCTTC -3'
(R):5'- CTGATCTGATCGTAAGCTTGTTTG -3'
Posted On2020-06-30