Incidental Mutation 'R0702:Trpc5'
ID63069
Institutional Source Beutler Lab
Gene Symbol Trpc5
Ensembl Gene ENSMUSG00000041710
Gene Nametransient receptor potential cation channel, subfamily C, member 5
SynonymsTRP5, Trrp5, CCE2
MMRRC Submission 038885-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0702 (G1)
Quality Score225
Status Not validated
ChromosomeX
Chromosomal Location144381671-144688180 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 144411739 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 590 (V590A)
Ref Sequence ENSEMBL: ENSMUSP00000049063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040184]
Predicted Effect probably damaging
Transcript: ENSMUST00000040184
AA Change: V590A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000049063
Gene: ENSMUSG00000041710
AA Change: V590A

DomainStartEndE-ValueType
Blast:ANK 31 63 6e-12 BLAST
ANK 69 98 3.54e-1 SMART
ANK 141 170 6.71e-2 SMART
Pfam:TRP_2 176 238 1.1e-30 PFAM
transmembrane domain 328 350 N/A INTRINSIC
Pfam:Ion_trans 364 636 2e-32 PFAM
low complexity region 842 853 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the transient receptor family. It encodes one of the seven mammalian TRPC (transient receptor potential channel) proteins. The encoded protein is a multi-pass membrane protein and is thought to form a receptor-activated non-selective calcium permeant cation channel. The protein is active alone or as a heteromultimeric assembly with TRPC1, TRPC3, and TRPC4. It also interacts with multiple proteins including calmodulin, CABP1, enkurin, Na(+)-H+ exchange regulatory factor (NHERF ), interferon-induced GTP-binding protein (MX1), ring finger protein 24 (RNF24), and SEC14 domain and spectrin repeat-containing protein 1 (SESTD1). [provided by RefSeq, May 2010]
PHENOTYPE: Mice with homozygous null alleles of the gene exhibit diminished innate fear response with reduction in synaptic activation and strength in neurons of the amygdala. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd11 A T 8: 122,889,766 I2428N probably damaging Het
Ano9 A G 7: 141,107,282 V348A probably damaging Het
Cfap69 A G 5: 5,644,465 I132T probably benign Het
Chd1l C T 3: 97,566,794 D791N probably benign Het
Chl1 A G 6: 103,706,622 Y819C probably damaging Het
Col5a2 T A 1: 45,380,131 D1263V possibly damaging Het
Csnk1g1 C T 9: 66,010,493 R45W probably damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Dgat2l6 G A X: 100,542,681 V180M probably damaging Het
Fscb G A 12: 64,472,001 P897L unknown Het
Herc6 T C 6: 57,581,107 L24P probably damaging Het
Il23r T A 6: 67,466,285 Q278L probably damaging Het
Kpna4 A T 3: 69,084,105 V361D probably damaging Het
Muc1 A G 3: 89,230,220 D123G probably benign Het
Notch4 A G 17: 34,575,203 Y722C probably damaging Het
Ntng1 G C 3: 109,872,254 R336G probably damaging Het
Olfr199 T C 16: 59,215,699 M305V probably benign Het
Pgbd5 C T 8: 124,374,255 V421M probably benign Het
Prkdc A G 16: 15,785,971 T2950A possibly damaging Het
Proser3 A T 7: 30,539,530 D630E probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Serpina3g A G 12: 104,241,253 E225G probably damaging Het
Slc2a13 T C 15: 91,321,667 D439G probably benign Het
Srebf2 T C 15: 82,177,409 L352P probably damaging Het
Ubqln2 A T X: 153,499,669 M406L possibly damaging Het
Other mutations in Trpc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02177:Trpc5 APN X 144481238 missense probably damaging 1.00
IGL02429:Trpc5 APN X 144411799 missense probably damaging 0.98
IGL03195:Trpc5 APN X 144382728 missense probably benign
R0494:Trpc5 UTSW X 144481396 missense probably damaging 1.00
R1756:Trpc5 UTSW X 144481226 missense probably damaging 1.00
R4065:Trpc5 UTSW X 144419598 nonsense probably null
R4066:Trpc5 UTSW X 144419598 nonsense probably null
R4067:Trpc5 UTSW X 144419598 nonsense probably null
X0013:Trpc5 UTSW X 144427584 missense probably benign 0.05
Z1176:Trpc5 UTSW X 144427746 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCCATTGGAAAGCAGTTACTCAC -3'
(R):5'- AGGAGATACATGAGCAGGCCACTC -3'

Sequencing Primer
(F):5'- TTACTCACGGCAATGAGCTGG -3'
(R):5'- ccccccatacccacccc -3'
Posted On2013-07-30