Mutagenetix > Incidental Mutation

Incidental Mutation 'R8105:Spef2'

630696

Institutional Source

Beutler Lab

Gene Symbol

Spef2

Ensembl Gene

ENSMUSG00000072663

Gene Name

sperm flagellar 2

Synonyms

C230086A09Rik

MMRRC Submission

067536-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.092) question?

Stock #

R8105 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

9578279-9748954 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 9682748 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Histidine at position 578 (N578H)

Ref Sequence

ENSEMBL: ENSMUSP00000035762 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041840] [ENSMUST00000159093] [ENSMUST00000160236] [ENSMUST00000208854]

AlphaFold

Q8C9J3

Predicted Effect

probably benign
Transcript: ENSMUST00000041840
AA Change: N578H

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000035762
Gene: ENSMUSG00000072663
AA Change: N578H

Domain	Start	End	E-Value	Type
Pfam:DUF1042	5	161	2.8e-59	PFAM
coiled coil region	171	203	N/A	INTRINSIC
low complexity region	247	256	N/A	INTRINSIC
coiled coil region	312	345	N/A	INTRINSIC
Pfam:ADK	600	829	5.9e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000159093

SMART Domains

Protein: ENSMUSP00000124891
Gene: ENSMUSG00000072663

Domain	Start	End	E-Value	Type
Pfam:DUF1042	5	166	3.5e-57	PFAM
coiled coil region	167	205	N/A	INTRINSIC
low complexity region	208	220	N/A	INTRINSIC
coiled coil region	228	260	N/A	INTRINSIC
low complexity region	304	313	N/A	INTRINSIC
coiled coil region	369	402	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000160236
AA Change: N578H

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000124222
Gene: ENSMUSG00000072663
AA Change: N578H

Domain	Start	End	E-Value	Type
Pfam:DUF1042	5	160	4.6e-59	PFAM
coiled coil region	171	203	N/A	INTRINSIC
low complexity region	247	256	N/A	INTRINSIC
coiled coil region	312	345	N/A	INTRINSIC
Pfam:ADK	600	787	3.7e-10	PFAM
low complexity region	819	855	N/A	INTRINSIC
low complexity region	899	907	N/A	INTRINSIC
low complexity region	1201	1225	N/A	INTRINSIC
low complexity region	1254	1268	N/A	INTRINSIC
low complexity region	1349	1359	N/A	INTRINSIC
SCOP:d1rec__	1368	1520	3e-3	SMART
low complexity region	1595	1614	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000208854
AA Change: N578H

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

100% (29/29)

MGI Phenotype

PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit male infertility due to oligospermia and abnormal spermatogenesis, hydroencephaly, sinusitis, and background-dependent lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arid1b	G	A	17: 5,341,518 (GRCm39)	A941T	possibly damaging	Het
Calb1	A	T	4: 15,900,767 (GRCm39)		probably null	Het
Cc2d1b	T	C	4: 108,485,130 (GRCm39)	S518P	possibly damaging	Het
Clpsl2	G	A	17: 28,769,702 (GRCm39)	G55R	probably damaging	Het
Cltc	C	T	11: 86,598,438 (GRCm39)	V975I	probably damaging	Het
Cntn4	T	C	6: 106,330,567 (GRCm39)	W62R	probably damaging	Het
Crot	A	G	5: 9,027,505 (GRCm39)	Y276H	probably damaging	Het
Dnah5	T	C	15: 28,372,548 (GRCm39)	V2933A	probably benign	Het
Evl	C	T	12: 108,647,783 (GRCm39)	R295*	probably null	Het
Fhod1	T	C	8: 106,063,847 (GRCm39)	T253A	unknown	Het
Fndc3b	G	A	3: 27,524,374 (GRCm39)	T462I	probably benign	Het
Folh1	A	T	7: 86,395,354 (GRCm39)	N359K	probably damaging	Het
Gmppa	T	C	1: 75,413,641 (GRCm39)	V34A	possibly damaging	Het
Ift140	A	G	17: 25,255,949 (GRCm39)	T484A	probably benign	Het
Lrrtm2	T	C	18: 35,346,510 (GRCm39)	E264G	probably damaging	Het
Luc7l2	T	C	6: 38,569,588 (GRCm39)	F182S	probably benign	Het
Ly9	G	C	1: 171,432,890 (GRCm39)		probably null	Het
Meox2	C	T	12: 37,159,061 (GRCm39)	H78Y	possibly damaging	Het
Mynn	G	A	3: 30,665,628 (GRCm39)	C420Y	possibly damaging	Het
Or52e18	C	G	7: 104,609,629 (GRCm39)	M103I	probably benign	Het
Rfx1	C	G	8: 84,814,505 (GRCm39)	A358G	possibly damaging	Het
Rnf151	G	A	17: 24,935,400 (GRCm39)	T177I	probably benign	Het
Stpg2	A	G	3: 138,948,925 (GRCm39)	I240M	probably damaging	Het
Tln1	C	T	4: 43,538,231 (GRCm39)	V1824I	probably benign	Het
Ugt3a1	T	A	15: 9,306,476 (GRCm39)	F208L	probably benign	Het
Vldlr	C	T	19: 27,216,204 (GRCm39)	Q342*	probably null	Het
Vmn1r14	T	A	6: 57,211,245 (GRCm39)	F274L	probably benign	Het
Xrcc6	T	C	15: 81,915,352 (GRCm39)	L435P	probably damaging	Het

Other mutations in Spef2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00490:Spef2	APN	15	9,740,621 (GRCm39)	missense	probably damaging	1.00
IGL00886:Spef2	APN	15	9,663,181 (GRCm39)	missense	probably damaging	1.00
IGL01409:Spef2	APN	15	9,716,499 (GRCm39)	missense	probably damaging	1.00
IGL01413:Spef2	APN	15	9,676,376 (GRCm39)	missense	probably benign	0.16
IGL01474:Spef2	APN	15	9,663,244 (GRCm39)	missense	probably benign	0.00
IGL01603:Spef2	APN	15	9,704,466 (GRCm39)	missense	probably damaging	0.99
IGL02320:Spef2	APN	15	9,717,662 (GRCm39)	missense	probably damaging	0.99
IGL02570:Spef2	APN	15	9,717,584 (GRCm39)	nonsense	probably null
IGL02605:Spef2	APN	15	9,725,238 (GRCm39)	missense	probably damaging	0.99
IGL02890:Spef2	APN	15	9,748,853 (GRCm39)	start codon destroyed	probably null	1.00
IGL02904:Spef2	APN	15	9,679,432 (GRCm39)	missense	probably damaging	1.00
IGL02942:Spef2	APN	15	9,668,960 (GRCm39)	missense	possibly damaging	0.71
IGL02953:Spef2	APN	15	9,713,329 (GRCm39)	missense	possibly damaging	0.82
IGL02965:Spef2	APN	15	9,725,192 (GRCm39)	splice site	probably benign
IGL03263:Spef2	APN	15	9,667,305 (GRCm39)	missense	possibly damaging	0.72
IGL03302:Spef2	APN	15	9,676,466 (GRCm39)	missense	probably benign	0.01
R0101:Spef2	UTSW	15	9,713,194 (GRCm39)	missense	probably damaging	1.00
R0101:Spef2	UTSW	15	9,713,194 (GRCm39)	missense	probably damaging	1.00
R0183:Spef2	UTSW	15	9,716,445 (GRCm39)	missense	possibly damaging	0.70
R0386:Spef2	UTSW	15	9,584,148 (GRCm39)	missense	probably damaging	1.00
R0511:Spef2	UTSW	15	9,584,070 (GRCm39)	critical splice donor site	probably null
R0617:Spef2	UTSW	15	9,592,844 (GRCm39)	missense	probably damaging	1.00
R0655:Spef2	UTSW	15	9,626,217 (GRCm39)	missense	possibly damaging	0.96
R0829:Spef2	UTSW	15	9,687,899 (GRCm39)	missense	probably benign	0.10
R0908:Spef2	UTSW	15	9,614,281 (GRCm39)	splice site	probably null
R0939:Spef2	UTSW	15	9,704,636 (GRCm39)	splice site	probably null
R0973:Spef2	UTSW	15	9,716,482 (GRCm39)	missense	probably damaging	1.00
R1371:Spef2	UTSW	15	9,725,194 (GRCm39)	splice site	probably benign
R1392:Spef2	UTSW	15	9,647,349 (GRCm39)	missense	probably benign	0.15
R1392:Spef2	UTSW	15	9,647,349 (GRCm39)	missense	probably benign	0.15
R1428:Spef2	UTSW	15	9,596,793 (GRCm39)	unclassified	probably benign
R1518:Spef2	UTSW	15	9,667,316 (GRCm39)	missense	probably damaging	1.00
R1585:Spef2	UTSW	15	9,596,660 (GRCm39)	missense	probably damaging	1.00
R1654:Spef2	UTSW	15	9,634,738 (GRCm39)	missense	probably damaging	0.99
R1723:Spef2	UTSW	15	9,614,295 (GRCm39)	missense	probably damaging	1.00
R1757:Spef2	UTSW	15	9,717,568 (GRCm39)	missense	probably damaging	1.00
R1812:Spef2	UTSW	15	9,679,435 (GRCm39)	missense	probably damaging	1.00
R1817:Spef2	UTSW	15	9,584,194 (GRCm39)	missense	probably damaging	0.96
R1818:Spef2	UTSW	15	9,584,194 (GRCm39)	missense	probably damaging	0.96
R1873:Spef2	UTSW	15	9,584,194 (GRCm39)	missense	probably damaging	0.96
R1875:Spef2	UTSW	15	9,597,487 (GRCm39)	missense	possibly damaging	0.78
R1875:Spef2	UTSW	15	9,584,194 (GRCm39)	missense	probably damaging	0.96
R1897:Spef2	UTSW	15	9,729,740 (GRCm39)	nonsense	probably null
R1901:Spef2	UTSW	15	9,607,463 (GRCm39)	missense	probably damaging	1.00
R1902:Spef2	UTSW	15	9,607,463 (GRCm39)	missense	probably damaging	1.00
R1943:Spef2	UTSW	15	9,663,280 (GRCm39)	missense	possibly damaging	0.76
R1968:Spef2	UTSW	15	9,609,602 (GRCm39)	missense	probably damaging	1.00
R1973:Spef2	UTSW	15	9,663,152 (GRCm39)	makesense	probably null
R1998:Spef2	UTSW	15	9,668,989 (GRCm39)	critical splice acceptor site	probably null
R1999:Spef2	UTSW	15	9,668,989 (GRCm39)	critical splice acceptor site	probably null
R2008:Spef2	UTSW	15	9,713,271 (GRCm39)	missense	possibly damaging	0.95
R2111:Spef2	UTSW	15	9,589,659 (GRCm39)	missense	probably damaging	1.00
R2127:Spef2	UTSW	15	9,729,747 (GRCm39)	missense	possibly damaging	0.53
R2405:Spef2	UTSW	15	9,626,120 (GRCm39)	nonsense	probably null
R2517:Spef2	UTSW	15	9,725,283 (GRCm39)	missense	possibly damaging	0.93
R2889:Spef2	UTSW	15	9,630,699 (GRCm39)	missense	probably damaging	0.99
R2988:Spef2	UTSW	15	9,682,709 (GRCm39)	missense	probably benign	0.43
R3792:Spef2	UTSW	15	9,704,622 (GRCm39)	missense	probably damaging	1.00
R4154:Spef2	UTSW	15	9,626,107 (GRCm39)	missense	probably benign	0.13
R4159:Spef2	UTSW	15	9,676,407 (GRCm39)	missense	probably damaging	1.00
R4199:Spef2	UTSW	15	9,667,366 (GRCm39)	missense	probably damaging	1.00
R4320:Spef2	UTSW	15	9,679,429 (GRCm39)	missense	possibly damaging	0.93
R4321:Spef2	UTSW	15	9,679,429 (GRCm39)	missense	possibly damaging	0.93
R4568:Spef2	UTSW	15	9,647,303 (GRCm39)	missense	probably damaging	1.00
R4625:Spef2	UTSW	15	9,647,524 (GRCm39)	missense	probably damaging	1.00
R4669:Spef2	UTSW	15	9,676,459 (GRCm39)	missense	probably benign	0.42
R4684:Spef2	UTSW	15	9,647,576 (GRCm39)	missense	probably benign	0.44
R4761:Spef2	UTSW	15	9,653,040 (GRCm39)	missense	probably damaging	1.00
R4839:Spef2	UTSW	15	9,713,264 (GRCm39)	nonsense	probably null
R5004:Spef2	UTSW	15	9,578,413 (GRCm39)	missense	probably benign	0.02
R5157:Spef2	UTSW	15	9,668,877 (GRCm39)	nonsense	probably null
R5230:Spef2	UTSW	15	9,667,316 (GRCm39)	missense	possibly damaging	0.62
R5315:Spef2	UTSW	15	9,596,777 (GRCm39)	missense	probably damaging	0.98
R5400:Spef2	UTSW	15	9,614,367 (GRCm39)	missense	probably damaging	1.00
R5591:Spef2	UTSW	15	9,583,922 (GRCm39)	missense	probably benign	0.02
R5599:Spef2	UTSW	15	9,729,789 (GRCm39)	missense	possibly damaging	0.53
R5605:Spef2	UTSW	15	9,609,606 (GRCm39)	missense	probably damaging	0.96
R5787:Spef2	UTSW	15	9,748,812 (GRCm39)	missense	possibly damaging	0.91
R5939:Spef2	UTSW	15	9,614,301 (GRCm39)	missense	probably benign	0.16
R6177:Spef2	UTSW	15	9,727,618 (GRCm39)	missense	possibly damaging	0.89
R6641:Spef2	UTSW	15	9,626,059 (GRCm39)	missense	probably damaging	1.00
R6665:Spef2	UTSW	15	9,600,604 (GRCm39)	critical splice donor site	probably null
R6944:Spef2	UTSW	15	9,592,835 (GRCm39)	missense	probably damaging	1.00
R6956:Spef2	UTSW	15	9,685,021 (GRCm39)	missense	probably damaging	1.00
R6968:Spef2	UTSW	15	9,597,426 (GRCm39)	missense	probably benign	0.02
R7089:Spef2	UTSW	15	9,725,257 (GRCm39)	missense	probably damaging	1.00
R7117:Spef2	UTSW	15	9,729,924 (GRCm39)	missense	probably damaging	1.00
R7161:Spef2	UTSW	15	9,717,689 (GRCm39)	missense	probably benign	0.29
R7223:Spef2	UTSW	15	9,601,726 (GRCm39)	missense	unknown
R7263:Spef2	UTSW	15	9,653,098 (GRCm39)	splice site	probably null
R7270:Spef2	UTSW	15	9,600,066 (GRCm39)	critical splice donor site	probably null
R7303:Spef2	UTSW	15	9,647,576 (GRCm39)	missense	possibly damaging	0.92
R7369:Spef2	UTSW	15	9,584,293 (GRCm39)	missense	probably benign	0.02
R7464:Spef2	UTSW	15	9,740,671 (GRCm39)	missense	probably benign	0.23
R7498:Spef2	UTSW	15	9,727,625 (GRCm39)	missense	probably benign
R7587:Spef2	UTSW	15	9,713,305 (GRCm39)	missense	probably damaging	1.00
R7748:Spef2	UTSW	15	9,653,031 (GRCm39)	missense	probably damaging	0.98
R7772:Spef2	UTSW	15	9,704,567 (GRCm39)	missense	probably damaging	0.99
R7838:Spef2	UTSW	15	9,609,637 (GRCm39)	missense	possibly damaging	0.53
R7854:Spef2	UTSW	15	9,596,730 (GRCm39)	missense	possibly damaging	0.77
R7855:Spef2	UTSW	15	9,687,981 (GRCm39)	missense	possibly damaging	0.53
R7889:Spef2	UTSW	15	9,717,649 (GRCm39)	missense	probably damaging	1.00
R7943:Spef2	UTSW	15	9,601,171 (GRCm39)	missense	unknown
R8151:Spef2	UTSW	15	9,601,598 (GRCm39)	missense	unknown
R8296:Spef2	UTSW	15	9,727,629 (GRCm39)	missense	probably benign	0.06
R8393:Spef2	UTSW	15	9,676,615 (GRCm39)	missense	probably benign	0.27
R8405:Spef2	UTSW	15	9,612,643 (GRCm39)	missense	probably benign	0.00
R8552:Spef2	UTSW	15	9,600,765 (GRCm39)	intron	probably benign
R8691:Spef2	UTSW	15	9,602,005 (GRCm39)	nonsense	probably null
R8751:Spef2	UTSW	15	9,729,723 (GRCm39)	nonsense	probably null
R8847:Spef2	UTSW	15	9,668,913 (GRCm39)	missense	probably benign
R8864:Spef2	UTSW	15	9,599,833 (GRCm39)	missense	unknown
R8868:Spef2	UTSW	15	9,729,747 (GRCm39)	missense	possibly damaging	0.53
R8916:Spef2	UTSW	15	9,725,266 (GRCm39)	nonsense	probably null
R8935:Spef2	UTSW	15	9,607,436 (GRCm39)	missense	probably damaging	0.98
R8961:Spef2	UTSW	15	9,647,414 (GRCm39)	missense	possibly damaging	0.92
R8978:Spef2	UTSW	15	9,725,263 (GRCm39)	missense	possibly damaging	0.81
R9062:Spef2	UTSW	15	9,601,717 (GRCm39)	missense	unknown
R9076:Spef2	UTSW	15	9,653,091 (GRCm39)	missense	probably benign	0.13
R9149:Spef2	UTSW	15	9,717,568 (GRCm39)	missense	probably damaging	1.00
R9162:Spef2	UTSW	15	9,602,017 (GRCm39)	missense	unknown
R9216:Spef2	UTSW	15	9,647,611 (GRCm39)	missense	probably damaging	1.00
R9240:Spef2	UTSW	15	9,578,401 (GRCm39)	nonsense	probably null
R9278:Spef2	UTSW	15	9,727,495 (GRCm39)	critical splice donor site	probably null
R9341:Spef2	UTSW	15	9,713,190 (GRCm39)	missense	probably damaging	1.00
R9343:Spef2	UTSW	15	9,713,190 (GRCm39)	missense	probably damaging	1.00
R9389:Spef2	UTSW	15	9,725,307 (GRCm39)	missense	probably damaging	0.96
R9476:Spef2	UTSW	15	9,713,203 (GRCm39)	missense	probably damaging	1.00
R9510:Spef2	UTSW	15	9,713,203 (GRCm39)	missense	probably damaging	1.00
R9537:Spef2	UTSW	15	9,601,885 (GRCm39)	missense	unknown
R9575:Spef2	UTSW	15	9,596,672 (GRCm39)	missense	probably damaging	1.00
R9597:Spef2	UTSW	15	9,599,897 (GRCm39)	missense	unknown
R9765:Spef2	UTSW	15	9,601,945 (GRCm39)	missense	unknown
X0025:Spef2	UTSW	15	9,596,708 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCACTCTTTTCATGCATACATACA -3'
(R):5'- GTACTTGCTTCTGGAAATCATTAAAG -3'

Sequencing Primer
(F):5'- GTGACTCGTTTTGACACG -3'
(R):5'- CTATTGGATGGATCACATGGCCC -3'

Posted On

2020-06-30