Incidental Mutation 'R8105:Arid1b'
ID 630699
Institutional Source Beutler Lab
Gene Symbol Arid1b
Ensembl Gene ENSMUSG00000069729
Gene Name AT-rich interaction domain 1B
Synonyms 9330189K18Rik, B230217J03Rik
MMRRC Submission 067536-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.783) question?
Stock # R8105 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 5044607-5397931 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 5341518 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 941 (A941T)
Ref Sequence ENSEMBL: ENSMUSP00000090398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092723] [ENSMUST00000115797] [ENSMUST00000115799] [ENSMUST00000232180]
AlphaFold E9Q4N7
Predicted Effect possibly damaging
Transcript: ENSMUST00000092723
AA Change: A941T

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000090398
Gene: ENSMUSG00000069729
AA Change: A941T

DomainStartEndE-ValueType
low complexity region 2 51 N/A INTRINSIC
low complexity region 69 132 N/A INTRINSIC
low complexity region 139 150 N/A INTRINSIC
low complexity region 201 224 N/A INTRINSIC
low complexity region 232 247 N/A INTRINSIC
low complexity region 257 276 N/A INTRINSIC
low complexity region 301 371 N/A INTRINSIC
low complexity region 379 407 N/A INTRINSIC
low complexity region 438 476 N/A INTRINSIC
low complexity region 485 499 N/A INTRINSIC
low complexity region 538 558 N/A INTRINSIC
low complexity region 574 591 N/A INTRINSIC
low complexity region 596 611 N/A INTRINSIC
low complexity region 615 640 N/A INTRINSIC
low complexity region 691 707 N/A INTRINSIC
low complexity region 719 740 N/A INTRINSIC
low complexity region 743 773 N/A INTRINSIC
low complexity region 805 816 N/A INTRINSIC
low complexity region 912 930 N/A INTRINSIC
low complexity region 936 952 N/A INTRINSIC
low complexity region 974 985 N/A INTRINSIC
low complexity region 1036 1045 N/A INTRINSIC
ARID 1057 1147 9.9e-33 SMART
BRIGHT 1061 1152 7.62e-41 SMART
low complexity region 1166 1177 N/A INTRINSIC
low complexity region 1257 1268 N/A INTRINSIC
low complexity region 1336 1364 N/A INTRINSIC
low complexity region 1426 1456 N/A INTRINSIC
low complexity region 1473 1486 N/A INTRINSIC
low complexity region 1579 1595 N/A INTRINSIC
coiled coil region 1724 1745 N/A INTRINSIC
low complexity region 1835 1843 N/A INTRINSIC
Pfam:DUF3518 1933 2189 1.5e-152 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115797
AA Change: A889T

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000111463
Gene: ENSMUSG00000069729
AA Change: A889T

DomainStartEndE-ValueType
low complexity region 17 80 N/A INTRINSIC
low complexity region 87 98 N/A INTRINSIC
low complexity region 149 172 N/A INTRINSIC
low complexity region 180 195 N/A INTRINSIC
low complexity region 205 224 N/A INTRINSIC
low complexity region 249 319 N/A INTRINSIC
low complexity region 327 355 N/A INTRINSIC
low complexity region 386 424 N/A INTRINSIC
low complexity region 433 447 N/A INTRINSIC
low complexity region 486 506 N/A INTRINSIC
low complexity region 522 539 N/A INTRINSIC
low complexity region 544 559 N/A INTRINSIC
low complexity region 563 588 N/A INTRINSIC
low complexity region 639 655 N/A INTRINSIC
low complexity region 667 688 N/A INTRINSIC
low complexity region 691 721 N/A INTRINSIC
low complexity region 753 764 N/A INTRINSIC
low complexity region 860 878 N/A INTRINSIC
low complexity region 884 900 N/A INTRINSIC
low complexity region 922 933 N/A INTRINSIC
Blast:ARID 981 1028 1e-8 BLAST
low complexity region 1029 1054 N/A INTRINSIC
ARID 1058 1148 9.9e-33 SMART
BRIGHT 1062 1153 7.62e-41 SMART
low complexity region 1167 1178 N/A INTRINSIC
low complexity region 1258 1269 N/A INTRINSIC
low complexity region 1337 1365 N/A INTRINSIC
low complexity region 1427 1457 N/A INTRINSIC
low complexity region 1474 1487 N/A INTRINSIC
low complexity region 1580 1596 N/A INTRINSIC
coiled coil region 1725 1746 N/A INTRINSIC
low complexity region 1836 1844 N/A INTRINSIC
Pfam:DUF3518 1935 2190 6.3e-121 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115799
AA Change: A407T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111465
Gene: ENSMUSG00000069729
AA Change: A407T

DomainStartEndE-ValueType
low complexity region 34 54 N/A INTRINSIC
low complexity region 70 87 N/A INTRINSIC
low complexity region 92 107 N/A INTRINSIC
low complexity region 111 136 N/A INTRINSIC
low complexity region 187 203 N/A INTRINSIC
low complexity region 215 236 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 378 396 N/A INTRINSIC
low complexity region 402 418 N/A INTRINSIC
low complexity region 440 451 N/A INTRINSIC
Blast:ARID 499 546 1e-8 BLAST
low complexity region 547 572 N/A INTRINSIC
ARID 576 666 9.9e-33 SMART
BRIGHT 580 671 7.62e-41 SMART
low complexity region 685 696 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
low complexity region 855 883 N/A INTRINSIC
low complexity region 945 975 N/A INTRINSIC
low complexity region 992 1005 N/A INTRINSIC
low complexity region 1098 1114 N/A INTRINSIC
coiled coil region 1243 1264 N/A INTRINSIC
low complexity region 1354 1362 N/A INTRINSIC
Pfam:DUF3518 1452 1708 1.1e-152 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000232180
AA Change: A941T

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.2491 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an AT-rich DNA interacting domain-containing protein. The encoded protein is a component of the SWI/SNF chromatin remodeling complex and may play a role in cell-cycle activation. The protein encoded by this locus is similar to AT-rich interactive domain-containing protein 1A. These two proteins function as alternative, mutually exclusive ARID-subunits of the SWI/SNF complex. The associated complexes play opposing roles. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]
Allele List at MGI

All alleles(61) : Targeted(2) Gene trapped(59)

Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Calb1 A T 4: 15,900,767 (GRCm39) probably null Het
Cc2d1b T C 4: 108,485,130 (GRCm39) S518P possibly damaging Het
Clpsl2 G A 17: 28,769,702 (GRCm39) G55R probably damaging Het
Cltc C T 11: 86,598,438 (GRCm39) V975I probably damaging Het
Cntn4 T C 6: 106,330,567 (GRCm39) W62R probably damaging Het
Crot A G 5: 9,027,505 (GRCm39) Y276H probably damaging Het
Dnah5 T C 15: 28,372,548 (GRCm39) V2933A probably benign Het
Evl C T 12: 108,647,783 (GRCm39) R295* probably null Het
Fhod1 T C 8: 106,063,847 (GRCm39) T253A unknown Het
Fndc3b G A 3: 27,524,374 (GRCm39) T462I probably benign Het
Folh1 A T 7: 86,395,354 (GRCm39) N359K probably damaging Het
Gmppa T C 1: 75,413,641 (GRCm39) V34A possibly damaging Het
Ift140 A G 17: 25,255,949 (GRCm39) T484A probably benign Het
Lrrtm2 T C 18: 35,346,510 (GRCm39) E264G probably damaging Het
Luc7l2 T C 6: 38,569,588 (GRCm39) F182S probably benign Het
Ly9 G C 1: 171,432,890 (GRCm39) probably null Het
Meox2 C T 12: 37,159,061 (GRCm39) H78Y possibly damaging Het
Mynn G A 3: 30,665,628 (GRCm39) C420Y possibly damaging Het
Or52e18 C G 7: 104,609,629 (GRCm39) M103I probably benign Het
Rfx1 C G 8: 84,814,505 (GRCm39) A358G possibly damaging Het
Rnf151 G A 17: 24,935,400 (GRCm39) T177I probably benign Het
Spef2 T G 15: 9,682,748 (GRCm39) N578H probably benign Het
Stpg2 A G 3: 138,948,925 (GRCm39) I240M probably damaging Het
Tln1 C T 4: 43,538,231 (GRCm39) V1824I probably benign Het
Ugt3a1 T A 15: 9,306,476 (GRCm39) F208L probably benign Het
Vldlr C T 19: 27,216,204 (GRCm39) Q342* probably null Het
Vmn1r14 T A 6: 57,211,245 (GRCm39) F274L probably benign Het
Xrcc6 T C 15: 81,915,352 (GRCm39) L435P probably damaging Het
Other mutations in Arid1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Arid1b APN 17 5,387,385 (GRCm39) missense possibly damaging 0.77
IGL00340:Arid1b APN 17 5,371,559 (GRCm39) missense probably damaging 1.00
IGL00886:Arid1b APN 17 5,177,254 (GRCm39) missense probably damaging 0.99
IGL01161:Arid1b APN 17 5,392,674 (GRCm39) missense probably damaging 1.00
IGL01391:Arid1b APN 17 5,369,133 (GRCm39) splice site probably benign
IGL01456:Arid1b APN 17 5,341,510 (GRCm39) missense probably damaging 1.00
IGL02152:Arid1b APN 17 5,364,243 (GRCm39) missense probably damaging 1.00
IGL02288:Arid1b APN 17 5,314,315 (GRCm39) missense possibly damaging 0.88
IGL02713:Arid1b APN 17 5,393,286 (GRCm39) missense probably damaging 1.00
IGL02858:Arid1b APN 17 5,392,166 (GRCm39) missense possibly damaging 0.92
IGL02885:Arid1b APN 17 5,392,428 (GRCm39) missense probably damaging 1.00
IGL02989:Arid1b APN 17 5,385,322 (GRCm39) missense probably damaging 1.00
FR4449:Arid1b UTSW 17 5,045,864 (GRCm39) small insertion probably benign
PIT4142001:Arid1b UTSW 17 5,389,518 (GRCm39) missense probably damaging 1.00
R0048:Arid1b UTSW 17 5,364,309 (GRCm39) critical splice donor site probably null
R0124:Arid1b UTSW 17 5,389,605 (GRCm39) missense probably damaging 1.00
R0153:Arid1b UTSW 17 5,393,207 (GRCm39) missense probably damaging 1.00
R0465:Arid1b UTSW 17 5,046,535 (GRCm39) missense possibly damaging 0.68
R0825:Arid1b UTSW 17 5,392,453 (GRCm39) missense probably damaging 1.00
R1172:Arid1b UTSW 17 5,389,575 (GRCm39) missense probably damaging 1.00
R1468:Arid1b UTSW 17 5,293,197 (GRCm39) missense probably damaging 0.99
R1468:Arid1b UTSW 17 5,293,197 (GRCm39) missense probably damaging 0.99
R1616:Arid1b UTSW 17 5,389,569 (GRCm39) missense probably damaging 1.00
R1754:Arid1b UTSW 17 5,329,476 (GRCm39) critical splice acceptor site probably null
R1760:Arid1b UTSW 17 5,392,088 (GRCm39) missense probably damaging 0.97
R1812:Arid1b UTSW 17 5,387,304 (GRCm39) missense probably benign 0.10
R1911:Arid1b UTSW 17 5,393,241 (GRCm39) missense probably damaging 1.00
R3874:Arid1b UTSW 17 5,386,790 (GRCm39) splice site probably null
R3913:Arid1b UTSW 17 5,392,532 (GRCm39) missense possibly damaging 0.94
R3916:Arid1b UTSW 17 5,392,928 (GRCm39) missense probably benign 0.25
R3922:Arid1b UTSW 17 5,393,316 (GRCm39) missense probably damaging 0.97
R4119:Arid1b UTSW 17 5,046,069 (GRCm39) unclassified probably benign
R4290:Arid1b UTSW 17 5,090,938 (GRCm39) missense probably damaging 1.00
R4291:Arid1b UTSW 17 5,090,938 (GRCm39) missense probably damaging 1.00
R4352:Arid1b UTSW 17 5,147,859 (GRCm39) missense possibly damaging 0.93
R4386:Arid1b UTSW 17 5,045,247 (GRCm39) unclassified probably benign
R4458:Arid1b UTSW 17 5,293,191 (GRCm39) missense probably damaging 0.99
R4524:Arid1b UTSW 17 5,147,895 (GRCm39) missense possibly damaging 0.93
R4622:Arid1b UTSW 17 5,045,325 (GRCm39) unclassified probably benign
R4723:Arid1b UTSW 17 5,387,565 (GRCm39) missense probably benign 0.01
R4782:Arid1b UTSW 17 5,389,496 (GRCm39) missense probably damaging 1.00
R4799:Arid1b UTSW 17 5,389,496 (GRCm39) missense probably damaging 1.00
R4910:Arid1b UTSW 17 5,392,478 (GRCm39) missense probably damaging 1.00
R4946:Arid1b UTSW 17 5,393,118 (GRCm39) missense probably damaging 0.99
R5083:Arid1b UTSW 17 5,364,293 (GRCm39) missense possibly damaging 0.54
R5204:Arid1b UTSW 17 5,393,316 (GRCm39) missense probably damaging 0.97
R5347:Arid1b UTSW 17 5,341,332 (GRCm39) nonsense probably null
R5553:Arid1b UTSW 17 5,364,152 (GRCm39) missense probably damaging 1.00
R5713:Arid1b UTSW 17 5,387,091 (GRCm39) missense probably damaging 1.00
R5820:Arid1b UTSW 17 5,046,529 (GRCm39) missense possibly damaging 0.96
R5992:Arid1b UTSW 17 5,045,231 (GRCm39) unclassified probably benign
R6038:Arid1b UTSW 17 5,386,957 (GRCm39) missense probably benign 0.07
R6038:Arid1b UTSW 17 5,386,957 (GRCm39) missense probably benign 0.07
R6153:Arid1b UTSW 17 5,293,107 (GRCm39) missense probably damaging 1.00
R6222:Arid1b UTSW 17 5,377,922 (GRCm39) critical splice acceptor site probably null
R6249:Arid1b UTSW 17 5,329,636 (GRCm39) missense possibly damaging 0.61
R6279:Arid1b UTSW 17 5,392,274 (GRCm39) missense probably damaging 1.00
R6329:Arid1b UTSW 17 5,387,538 (GRCm39) nonsense probably null
R6368:Arid1b UTSW 17 5,382,808 (GRCm39) missense possibly damaging 0.64
R6466:Arid1b UTSW 17 5,377,953 (GRCm39) missense probably damaging 1.00
R6861:Arid1b UTSW 17 5,377,961 (GRCm39) missense possibly damaging 0.93
R7008:Arid1b UTSW 17 5,341,254 (GRCm39) missense probably damaging 1.00
R7270:Arid1b UTSW 17 5,046,318 (GRCm39) missense unknown
R7514:Arid1b UTSW 17 5,391,989 (GRCm39) missense probably benign 0.28
R7519:Arid1b UTSW 17 5,046,128 (GRCm39) small insertion probably benign
R7519:Arid1b UTSW 17 5,046,119 (GRCm39) small insertion probably benign
R7521:Arid1b UTSW 17 5,392,865 (GRCm39) missense probably benign 0.06
R7521:Arid1b UTSW 17 5,046,119 (GRCm39) small insertion probably benign
R7521:Arid1b UTSW 17 5,046,135 (GRCm39) small insertion probably benign
R7616:Arid1b UTSW 17 5,045,661 (GRCm39) missense unknown
R7654:Arid1b UTSW 17 5,341,360 (GRCm39) missense possibly damaging 0.46
R7711:Arid1b UTSW 17 5,387,095 (GRCm39) missense probably benign 0.28
R7828:Arid1b UTSW 17 5,147,943 (GRCm39) missense probably damaging 1.00
R7864:Arid1b UTSW 17 5,392,530 (GRCm39) missense probably damaging 1.00
R7998:Arid1b UTSW 17 5,377,959 (GRCm39) missense probably damaging 1.00
R8260:Arid1b UTSW 17 5,382,788 (GRCm39) missense probably benign 0.03
R8374:Arid1b UTSW 17 5,392,919 (GRCm39) missense possibly damaging 0.95
R8779:Arid1b UTSW 17 5,391,809 (GRCm39) missense probably benign 0.03
R8801:Arid1b UTSW 17 5,387,103 (GRCm39) missense probably benign 0.05
R8894:Arid1b UTSW 17 5,377,668 (GRCm39) missense probably damaging 0.98
R8982:Arid1b UTSW 17 5,293,316 (GRCm39) missense probably damaging 0.98
R9034:Arid1b UTSW 17 5,387,180 (GRCm39) missense probably benign 0.01
R9272:Arid1b UTSW 17 5,386,879 (GRCm39) missense possibly damaging 0.80
R9300:Arid1b UTSW 17 5,293,274 (GRCm39) missense probably damaging 1.00
R9332:Arid1b UTSW 17 5,045,584 (GRCm39) missense unknown
R9481:Arid1b UTSW 17 5,369,007 (GRCm39) missense probably damaging 1.00
R9493:Arid1b UTSW 17 5,046,423 (GRCm39) missense unknown
R9512:Arid1b UTSW 17 5,391,864 (GRCm39) missense probably benign 0.00
R9548:Arid1b UTSW 17 5,385,262 (GRCm39) missense probably damaging 1.00
RF007:Arid1b UTSW 17 5,045,869 (GRCm39) small insertion probably benign
RF008:Arid1b UTSW 17 5,045,870 (GRCm39) small insertion probably benign
RF008:Arid1b UTSW 17 5,045,869 (GRCm39) small insertion probably benign
RF025:Arid1b UTSW 17 5,045,871 (GRCm39) small insertion probably benign
RF025:Arid1b UTSW 17 5,045,863 (GRCm39) small insertion probably benign
RF028:Arid1b UTSW 17 5,045,873 (GRCm39) small insertion probably benign
RF032:Arid1b UTSW 17 5,045,863 (GRCm39) small insertion probably benign
RF033:Arid1b UTSW 17 5,045,860 (GRCm39) small insertion probably benign
RF041:Arid1b UTSW 17 5,045,870 (GRCm39) small insertion probably benign
RF045:Arid1b UTSW 17 5,045,858 (GRCm39) small insertion probably benign
RF046:Arid1b UTSW 17 5,045,865 (GRCm39) small insertion probably benign
RF058:Arid1b UTSW 17 5,045,858 (GRCm39) small insertion probably benign
X0023:Arid1b UTSW 17 5,392,668 (GRCm39) missense probably benign 0.39
X0027:Arid1b UTSW 17 5,392,647 (GRCm39) nonsense probably null
Z1177:Arid1b UTSW 17 5,046,603 (GRCm39) missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- TGCCAACAACCAGATGCATGG -3'
(R):5'- GCAAGGCATGGCTGTTTTGC -3'

Sequencing Primer
(F):5'- ATGGACAAGGGCCAGCC -3'
(R):5'- GCTGTTTTGCCTACAGTCATAG -3'
Posted On 2020-06-30