Incidental Mutation 'R0702:Ubqln2'
ID63070
Institutional Source Beutler Lab
Gene Symbol Ubqln2
Ensembl Gene ENSMUSG00000050148
Gene Nameubiquilin 2
SynonymsDsk2, HRIHFB2157, Plic-2, Chap1
MMRRC Submission 038885-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R0702 (G1)
Quality Score102
Status Not validated
ChromosomeX
Chromosomal Location153498227-153501570 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 153499669 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 406 (M406L)
Ref Sequence ENSEMBL: ENSMUSP00000056888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060714]
Predicted Effect possibly damaging
Transcript: ENSMUST00000060714
AA Change: M406L

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000056888
Gene: ENSMUSG00000050148
AA Change: M406L

DomainStartEndE-ValueType
UBQ 33 103 5.81e-15 SMART
low complexity region 112 172 N/A INTRINSIC
STI1 189 217 1.23e1 SMART
STI1 219 258 2.39e-10 SMART
low complexity region 305 316 N/A INTRINSIC
low complexity region 336 371 N/A INTRINSIC
STI1 393 440 2.89e-9 SMART
STI1 444 476 1.23e1 SMART
low complexity region 503 551 N/A INTRINSIC
UBA 596 634 3.54e-6 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an ubiquitin-like protein (ubiquilin) that shares high degree of similarity with related products in yeast, rat and frog. Ubiquilins contain a N-terminal ubiquitin-like domain and a C-terminal ubiquitin-associated domain. They physically associate with both proteasomes and ubiquitin ligases; and thus, are thought to functionally link the ubiquitination machinery to the proteasome to affect in vivo protein degradation. This ubiquilin has also been shown to bind the ATPase domain of the Hsp70-like Stch protein. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd11 A T 8: 122,889,766 I2428N probably damaging Het
Ano9 A G 7: 141,107,282 V348A probably damaging Het
Cfap69 A G 5: 5,644,465 I132T probably benign Het
Chd1l C T 3: 97,566,794 D791N probably benign Het
Chl1 A G 6: 103,706,622 Y819C probably damaging Het
Col5a2 T A 1: 45,380,131 D1263V possibly damaging Het
Csnk1g1 C T 9: 66,010,493 R45W probably damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Dgat2l6 G A X: 100,542,681 V180M probably damaging Het
Fscb G A 12: 64,472,001 P897L unknown Het
Herc6 T C 6: 57,581,107 L24P probably damaging Het
Il23r T A 6: 67,466,285 Q278L probably damaging Het
Kpna4 A T 3: 69,084,105 V361D probably damaging Het
Muc1 A G 3: 89,230,220 D123G probably benign Het
Notch4 A G 17: 34,575,203 Y722C probably damaging Het
Ntng1 G C 3: 109,872,254 R336G probably damaging Het
Olfr199 T C 16: 59,215,699 M305V probably benign Het
Pgbd5 C T 8: 124,374,255 V421M probably benign Het
Prkdc A G 16: 15,785,971 T2950A possibly damaging Het
Proser3 A T 7: 30,539,530 D630E probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Serpina3g A G 12: 104,241,253 E225G probably damaging Het
Slc2a13 T C 15: 91,321,667 D439G probably benign Het
Srebf2 T C 15: 82,177,409 L352P probably damaging Het
Trpc5 A G X: 144,411,739 V590A probably damaging Het
Other mutations in Ubqln2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02364:Ubqln2 APN X 153499910 missense possibly damaging 0.90
IGL02948:Ubqln2 APN X 153499696 nonsense probably null
IGL03037:Ubqln2 APN X 153499696 nonsense probably null
Z1177:Ubqln2 UTSW X 153498499 missense unknown
Predicted Primers PCR Primer
(F):5'- TATGCTGAATGCCGCACAGGAG -3'
(R):5'- TTGACATGGCCGCGATGGTTTC -3'

Sequencing Primer
(F):5'- AGTTCCACCTCAGGGGAAG -3'
(R):5'- CTGGATTCTGCATCTGCTGC -3'
Posted On2013-07-30