Incidental Mutation 'R8108:Ndufs1'
ID 630705
Institutional Source Beutler Lab
Gene Symbol Ndufs1
Ensembl Gene ENSMUSG00000025968
Gene Name NADH dehydrogenase (ubiquinone) Fe-S protein 1
Synonyms 9930026A05Rik, 5830412M15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8108 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 63143596-63176833 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 63150012 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 551 (D551E)
Ref Sequence ENSEMBL: ENSMUSP00000027111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027111] [ENSMUST00000168099] [ENSMUST00000185847] [ENSMUST00000187756]
AlphaFold Q91VD9
Predicted Effect possibly damaging
Transcript: ENSMUST00000027111
AA Change: D551E

PolyPhen 2 Score 0.467 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027111
Gene: ENSMUSG00000025968
AA Change: D551E

DomainStartEndE-ValueType
Pfam:Fer2_4 29 107 8.5e-20 PFAM
Pfam:Fer2 34 97 1e-11 PFAM
NADH-G_4Fe-4S_3 113 153 6.5e-19 SMART
Pfam:Molybdopterin 301 629 1e-76 PFAM
Pfam:NADH_dhqG_C 658 710 1.5e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000168099
AA Change: D551E

PolyPhen 2 Score 0.467 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000126621
Gene: ENSMUSG00000025968
AA Change: D551E

DomainStartEndE-ValueType
Pfam:Fer2_4 29 107 4.3e-19 PFAM
Pfam:Fer2 34 97 1e-11 PFAM
NADH-G_4Fe-4S_3 113 153 6.5e-19 SMART
Pfam:Molybdopterin 301 629 1e-76 PFAM
Pfam:DUF1982 657 710 3.6e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185847
SMART Domains Protein: ENSMUSP00000141190
Gene: ENSMUSG00000025968

DomainStartEndE-ValueType
Pfam:Molybdopterin 1 60 5.7e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187756
Meta Mutation Damage Score 0.7404 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 97.3%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the complex I 75 kDa subunit family. Mammalian complex I is composed of 45 different subunits. It locates at the mitochondrial inner membrane. This protein has NADH dehydrogenase activity and oxidoreductase activity. It transfers electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone. This protein is the largest subunit of complex I and it is a component of the iron-sulfur (IP) fragment of the enzyme. It may form part of the active site crevice where NADH is oxidized. Mutations in this gene are associated with complex I deficiency. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot1 T A 12: 84,017,361 H414Q probably benign Het
Actrt2 A T 4: 154,667,036 D214E probably benign Het
Ccdc7a T C 8: 128,980,153 T332A unknown Het
Chd9 C T 8: 90,933,224 H271Y unknown Het
Depdc5 T G 5: 32,945,049 D966E probably benign Het
Dolpp1 A G 2: 30,396,246 Y119C probably benign Het
Dscam G C 16: 96,643,879 D1537E probably benign Het
Dusp16 A G 6: 134,739,873 I157T probably benign Het
Dyrk2 T C 10: 118,859,829 D508G probably benign Het
Endov T C 11: 119,507,411 V334A probably benign Het
Ep400 A T 5: 110,687,883 V1956E unknown Het
Erich3 A T 3: 154,720,115 Y83F possibly damaging Het
Fbrsl1 T C 5: 110,378,379 probably null Het
Gm1110 T C 9: 26,920,661 I65V probably damaging Het
Gm28374 A G 19: 6,082,200 V19A Het
Gm436 A T 4: 144,670,669 N164K probably benign Het
Gpr107 C A 2: 31,184,869 H336Q probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C Het
Grm1 C A 10: 10,720,132 R584L probably benign Het
Gse1 T C 8: 120,229,810 S347P unknown Het
Ier3ip1 T A 18: 76,940,525 I69K possibly damaging Het
Impact T G 18: 12,984,331 L154V probably benign Het
Katnb1 T C 8: 95,093,945 F141S possibly damaging Het
Kifap3 T A 1: 163,797,362 N162K probably damaging Het
Klhl5 A G 5: 65,148,587 probably null Het
Klre1 A G 6: 129,584,222 D182G probably benign Het
Krt42 T A 11: 100,266,957 Y227F probably benign Het
Lhcgr T A 17: 88,742,050 K683* probably null Het
Lrrc37a G A 11: 103,503,057 S514F probably benign Het
Lrrc9 G T 12: 72,454,059 L186F probably damaging Het
Metrn A G 17: 25,795,030 V274A probably benign Het
Mettl25 A T 10: 105,823,179 F414L possibly damaging Het
Mixl1 A G 1: 180,696,702 V104A probably damaging Het
Myo9b T A 8: 71,348,342 M1047K probably damaging Het
Nbea G A 3: 55,819,315 A2081V probably benign Het
Nectin3 T C 16: 46,464,121 T67A possibly damaging Het
Nme8 C T 13: 19,650,960 V519I probably benign Het
Npat G T 9: 53,571,129 G1379V probably benign Het
Obscn T A 11: 59,061,634 T3870S probably benign Het
Olfr1000 T C 2: 85,608,749 R54G possibly damaging Het
Olfr1288 T C 2: 111,479,234 V150A possibly damaging Het
Olfr177 T C 16: 58,872,236 M305V probably benign Het
Olfr379-ps1 T A 11: 73,433,854 H124L unknown Het
Olfr871 T A 9: 20,212,451 M34K possibly damaging Het
Olfr910 A G 9: 38,539,410 N172D probably damaging Het
Parp8 A T 13: 116,867,073 Y769* probably null Het
Pcnx C T 12: 81,918,819 R59* probably null Het
Pdzd2 G A 15: 12,373,506 S2181L probably benign Het
Phldb1 T C 9: 44,711,161 E65G probably damaging Het
Ppif C T 14: 25,698,326 T157M probably damaging Het
Ppp3ca T A 3: 136,932,225 probably null Het
Proser1 T A 3: 53,472,088 probably null Het
Reg3d T A 6: 78,376,079 K174* probably null Het
Rubcn A T 16: 32,856,950 L55Q probably damaging Het
Sec14l3 T C 11: 4,066,198 L39P probably damaging Het
Ska3 A G 14: 57,826,102 I4T probably damaging Het
Slc30a10 A G 1: 185,464,154 I338V possibly damaging Het
Slc35g1 C G 19: 38,402,829 S186R probably damaging Het
Slc35g1 T A 19: 38,402,831 L187H probably damaging Het
Spata5 T C 3: 37,431,782 S218P probably benign Het
Tbc1d5 T C 17: 50,742,086 I659V probably benign Het
Tbl3 G T 17: 24,700,916 D751E probably benign Het
Tdrd3 T A 14: 87,486,266 D311E possibly damaging Het
Tenm4 T C 7: 96,854,728 F1335S probably benign Het
Tm2d1 A T 4: 98,375,023 C83S probably damaging Het
Tnfrsf22 A T 7: 143,638,373 V192D unknown Het
Trpm6 A G 19: 18,811,790 T575A probably damaging Het
Uri1 T C 7: 37,981,673 D102G possibly damaging Het
Vmn2r1 T A 3: 64,103,050 C570S probably damaging Het
Vps13a C T 19: 16,640,787 V2906I probably damaging Het
Zfp472 T C 17: 32,978,003 Y351H possibly damaging Het
Zfp874a G T 13: 67,443,234 Y110* probably null Het
Zfp986 T A 4: 145,899,305 N178K probably benign Het
Other mutations in Ndufs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01082:Ndufs1 APN 1 63164817 missense probably damaging 0.99
IGL01655:Ndufs1 APN 1 63151557 missense probably damaging 1.00
IGL02532:Ndufs1 APN 1 63170139 missense probably damaging 0.99
IGL02606:Ndufs1 APN 1 63159852 missense probably damaging 1.00
IGL02866:Ndufs1 APN 1 63147141 missense probably benign 0.00
IGL03036:Ndufs1 APN 1 63163696 nonsense probably null
IGL03209:Ndufs1 APN 1 63164737 missense probably damaging 1.00
PIT4142001:Ndufs1 UTSW 1 63159748 unclassified probably benign
R0165:Ndufs1 UTSW 1 63159748 critical splice donor site probably null
R0505:Ndufs1 UTSW 1 63143926 splice site probably benign
R1861:Ndufs1 UTSW 1 63147417 missense probably benign 0.17
R2294:Ndufs1 UTSW 1 63160996 missense probably damaging 1.00
R2872:Ndufs1 UTSW 1 63164723 splice site probably benign
R2873:Ndufs1 UTSW 1 63164723 splice site probably benign
R4092:Ndufs1 UTSW 1 63157246 missense possibly damaging 0.55
R4277:Ndufs1 UTSW 1 63170097 missense possibly damaging 0.84
R4782:Ndufs1 UTSW 1 63160949 missense probably damaging 1.00
R4799:Ndufs1 UTSW 1 63160949 missense probably damaging 1.00
R4993:Ndufs1 UTSW 1 63163776 missense probably benign
R5051:Ndufs1 UTSW 1 63164947 critical splice donor site probably null
R5412:Ndufs1 UTSW 1 63166349 missense possibly damaging 0.79
R5632:Ndufs1 UTSW 1 63150059 missense probably benign 0.00
R5705:Ndufs1 UTSW 1 63147158 missense probably benign 0.05
R5854:Ndufs1 UTSW 1 63147389 missense probably benign 0.05
R5919:Ndufs1 UTSW 1 63143832 makesense probably null
R6598:Ndufs1 UTSW 1 63164950 missense probably null 1.00
R7716:Ndufs1 UTSW 1 63152857 missense possibly damaging 0.95
R7744:Ndufs1 UTSW 1 63160940 missense possibly damaging 0.89
R7785:Ndufs1 UTSW 1 63147399 missense probably damaging 0.98
R8200:Ndufs1 UTSW 1 63170172 splice site probably null
R8491:Ndufs1 UTSW 1 63157225 missense probably damaging 1.00
R9179:Ndufs1 UTSW 1 63170115 missense probably benign 0.01
Z1176:Ndufs1 UTSW 1 63163836 missense probably damaging 1.00
Z1177:Ndufs1 UTSW 1 63163808 missense probably damaging 1.00
Z1177:Ndufs1 UTSW 1 63169251 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACCTCTTAGTATGCATCAGGTATG -3'
(R):5'- AGAGACACTCTGCTATGCATC -3'

Sequencing Primer
(F):5'- ACAGGGTTTCTCTGTGTAGCCC -3'
(R):5'- CTGCTATGCATCTTATATTTCAGTGG -3'
Posted On 2020-06-30