Mutagenetix > Incidental Mutations

Incidental Mutation 'R8108:Kifap3'

630706

Institutional Source

Beutler Lab

Gene Symbol

Kifap3

Ensembl Gene

ENSMUSG00000026585

Gene Name

kinesin-associated protein 3

Synonyms

Smg GDS, KAP3

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8108 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

163779583-163917109 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 163797362 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 162 (N162K)

Ref Sequence

ENSEMBL: ENSMUSP00000027877 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027877] [ENSMUST00000077642]

AlphaFold

P70188

Predicted Effect

probably damaging
Transcript: ENSMUST00000027877
AA Change: N162K

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000027877
Gene: ENSMUSG00000026585
AA Change: N162K

Domain	Start	End	E-Value	Type
KAP	13	720	N/A	SMART
ARM	333	373	1.21e-3	SMART
ARM	374	412	9.68e0	SMART
ARM	578	620	1.28e-2	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000077642
AA Change: N162K

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000076830
Gene: ENSMUSG00000026585
AA Change: N162K

Domain	Start	End	E-Value	Type
KAP	13	720	N/A	SMART
ARM	333	373	1.21e-3	SMART
ARM	374	412	9.68e0	SMART
ARM	578	620	1.28e-2	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 99.0%
20x: 97.3%

Validation Efficiency

99% (72/73)

MGI Phenotype

FUNCTION: The protein encoded by this gene is the non-motor subunit of kinesin-2 complex, and forms a heterotrimer with two members of the kinesin superfamily of proteins that together form a microtubule plus-end directed translocator that plays an important role in intracellular transport, mitosis, and cell-cell adhesion. This protein contains multiple armadillo repeats involved in protein binding, and may serve as an adaptor to regulate binding of cargo with the motor proteins. Conditional disruption of this gene in mouse neural precursor cells caused a tumor-like phenotype and defective organization of the neuroepithelium thought to be the result of altered N-cadherin subcellular localization. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2015]
PHENOTYPE: About 70% of homozygotes for a knock-out mutation die of heart failure shortly after birth due to massive cardiomyocyte apoptosis triggered by cardiovascular overload. Neonatal thymocytes and developing neuronal cells undergo apoptosis while cultured thymocytes are susceptible to apoptotic inducers. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acot1	T	A	12: 84,017,361	H414Q	probably benign	Het
Actrt2	A	T	4: 154,667,036	D214E	probably benign	Het
Ccdc7a	T	C	8: 128,980,153	T332A	unknown	Het
Chd9	C	T	8: 90,933,224	H271Y	unknown	Het
Depdc5	T	G	5: 32,945,049	D966E	probably benign	Het
Dolpp1	A	G	2: 30,396,246	Y119C	probably benign	Het
Dscam	G	C	16: 96,643,879	D1537E	probably benign	Het
Dusp16	A	G	6: 134,739,873	I157T	probably benign	Het
Dyrk2	T	C	10: 118,859,829	D508G	probably benign	Het
Endov	T	C	11: 119,507,411	V334A	probably benign	Het
Ep400	A	T	5: 110,687,883	V1956E	unknown	Het
Erich3	A	T	3: 154,720,115	Y83F	possibly damaging	Het
Fbrsl1	T	C	5: 110,378,379		probably null	Het
Gm1110	T	C	9: 26,920,661	I65V	probably damaging	Het
Gm28374	A	G	19: 6,082,200	V19A		Het
Gm436	A	T	4: 144,670,669	N164K	probably benign	Het
Gpr107	C	A	2: 31,184,869	H336Q	probably damaging	Het
Gpr137b	T	C	13: 13,359,406	Y355C		Het
Grm1	C	A	10: 10,720,132	R584L	probably benign	Het
Gse1	T	C	8: 120,229,810	S347P	unknown	Het
Ier3ip1	T	A	18: 76,940,525	I69K	possibly damaging	Het
Impact	T	G	18: 12,984,331	L154V	probably benign	Het
Katnb1	T	C	8: 95,093,945	F141S	possibly damaging	Het
Klhl5	A	G	5: 65,148,587		probably null	Het
Klre1	A	G	6: 129,584,222	D182G	probably benign	Het
Krt42	T	A	11: 100,266,957	Y227F	probably benign	Het
Lhcgr	T	A	17: 88,742,050	K683*	probably null	Het
Lrrc37a	G	A	11: 103,503,057	S514F	probably benign	Het
Lrrc9	G	T	12: 72,454,059	L186F	probably damaging	Het
Metrn	A	G	17: 25,795,030	V274A	probably benign	Het
Mettl25	A	T	10: 105,823,179	F414L	possibly damaging	Het
Mixl1	A	G	1: 180,696,702	V104A	probably damaging	Het
Myo9b	T	A	8: 71,348,342	M1047K	probably damaging	Het
Nbea	G	A	3: 55,819,315	A2081V	probably benign	Het
Ndufs1	A	T	1: 63,150,012	D551E	possibly damaging	Het
Nectin3	T	C	16: 46,464,121	T67A	possibly damaging	Het
Nme8	C	T	13: 19,650,960	V519I	probably benign	Het
Npat	G	T	9: 53,571,129	G1379V	probably benign	Het
Obscn	T	A	11: 59,061,634	T3870S	probably benign	Het
Olfr1000	T	C	2: 85,608,749	R54G	possibly damaging	Het
Olfr1288	T	C	2: 111,479,234	V150A	possibly damaging	Het
Olfr177	T	C	16: 58,872,236	M305V	probably benign	Het
Olfr379-ps1	T	A	11: 73,433,854	H124L	unknown	Het
Olfr871	T	A	9: 20,212,451	M34K	possibly damaging	Het
Olfr910	A	G	9: 38,539,410	N172D	probably damaging	Het
Parp8	A	T	13: 116,867,073	Y769*	probably null	Het
Pcnx	C	T	12: 81,918,819	R59*	probably null	Het
Pdzd2	G	A	15: 12,373,506	S2181L	probably benign	Het
Phldb1	T	C	9: 44,711,161	E65G	probably damaging	Het
Ppif	C	T	14: 25,698,326	T157M	probably damaging	Het
Ppp3ca	T	A	3: 136,932,225		probably null	Het
Proser1	T	A	3: 53,472,088		probably null	Het
Reg3d	T	A	6: 78,376,079	K174*	probably null	Het
Rubcn	A	T	16: 32,856,950	L55Q	probably damaging	Het
Sec14l3	T	C	11: 4,066,198	L39P	probably damaging	Het
Ska3	A	G	14: 57,826,102	I4T	probably damaging	Het
Slc30a10	A	G	1: 185,464,154	I338V	possibly damaging	Het
Slc35g1	C	G	19: 38,402,829	S186R	probably damaging	Het
Slc35g1	T	A	19: 38,402,831	L187H	probably damaging	Het
Spata5	T	C	3: 37,431,782	S218P	probably benign	Het
Tbc1d5	T	C	17: 50,742,086	I659V	probably benign	Het
Tbl3	G	T	17: 24,700,916	D751E	probably benign	Het
Tdrd3	T	A	14: 87,486,266	D311E	possibly damaging	Het
Tenm4	T	C	7: 96,854,728	F1335S	probably benign	Het
Tm2d1	A	T	4: 98,375,023	C83S	probably damaging	Het
Tnfrsf22	A	T	7: 143,638,373	V192D	unknown	Het
Trpm6	A	G	19: 18,811,790	T575A	probably damaging	Het
Uri1	T	C	7: 37,981,673	D102G	possibly damaging	Het
Vmn2r1	T	A	3: 64,103,050	C570S	probably damaging	Het
Vps13a	C	T	19: 16,640,787	V2906I	probably damaging	Het
Zfp472	T	C	17: 32,978,003	Y351H	possibly damaging	Het
Zfp874a	G	T	13: 67,443,234	Y110*	probably null	Het
Zfp986	T	A	4: 145,899,305	N178K	probably benign	Het

Other mutations in Kifap3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00737:Kifap3	APN	1	163797270	missense	probably damaging	1.00
IGL01655:Kifap3	APN	1	163796049	splice site	probably benign
IGL02385:Kifap3	APN	1	163865444	nonsense	probably null
IGL02517:Kifap3	APN	1	163825871	splice site	probably benign
IGL02756:Kifap3	APN	1	163862028	missense	probably damaging	0.98
IGL03034:Kifap3	APN	1	163888277	missense	probably benign	0.05
IGL03230:Kifap3	APN	1	163825724	missense	probably benign	0.02
IGL03270:Kifap3	APN	1	163848733	missense	probably benign	0.18
IGL03340:Kifap3	APN	1	163829149	missense	possibly damaging	0.94
R0207:Kifap3	UTSW	1	163883386	missense	probably benign	0.00
R0333:Kifap3	UTSW	1	163797264	missense	probably damaging	1.00
R0426:Kifap3	UTSW	1	163865552	splice site	probably benign
R1467:Kifap3	UTSW	1	163829120	splice site	probably benign
R1482:Kifap3	UTSW	1	163825859	missense	possibly damaging	0.91
R1547:Kifap3	UTSW	1	163794086	missense	probably benign	0.01
R1704:Kifap3	UTSW	1	163829196	missense	possibly damaging	0.50
R1724:Kifap3	UTSW	1	163783097	nonsense	probably null
R1982:Kifap3	UTSW	1	163862022	nonsense	probably null
R2233:Kifap3	UTSW	1	163856065	missense	probably benign
R2273:Kifap3	UTSW	1	163868758	missense	possibly damaging	0.94
R2274:Kifap3	UTSW	1	163868758	missense	possibly damaging	0.94
R2275:Kifap3	UTSW	1	163868758	missense	possibly damaging	0.94
R3420:Kifap3	UTSW	1	163794026	missense	probably damaging	1.00
R3421:Kifap3	UTSW	1	163794026	missense	probably damaging	1.00
R3422:Kifap3	UTSW	1	163794026	missense	probably damaging	1.00
R4194:Kifap3	UTSW	1	163915825	missense	probably benign	0.10
R4260:Kifap3	UTSW	1	163862028	missense	probably damaging	0.98
R4464:Kifap3	UTSW	1	163817895	missense	probably benign	0.00
R4635:Kifap3	UTSW	1	163814435	missense	probably damaging	1.00
R5090:Kifap3	UTSW	1	163856076	missense	possibly damaging	0.89
R5426:Kifap3	UTSW	1	163779871	start codon destroyed	probably null	0.30
R5868:Kifap3	UTSW	1	163865472	missense	probably damaging	1.00
R6107:Kifap3	UTSW	1	163868769	missense	possibly damaging	0.50
R6437:Kifap3	UTSW	1	163857526	missense	probably damaging	0.99
R6744:Kifap3	UTSW	1	163848670	missense	probably benign	0.00
R7051:Kifap3	UTSW	1	163794080	missense	probably damaging	1.00
R7143:Kifap3	UTSW	1	163825859	missense	possibly damaging	0.91
R7143:Kifap3	UTSW	1	163856040	missense	possibly damaging	0.66
R7216:Kifap3	UTSW	1	163795989	missense	probably damaging	0.98
R7467:Kifap3	UTSW	1	163815833	missense	probably benign
R7564:Kifap3	UTSW	1	163915768	missense	probably damaging	1.00
R7939:Kifap3	UTSW	1	163815858	nonsense	probably null
R8496:Kifap3	UTSW	1	163829297	critical splice donor site	probably null
R9009:Kifap3	UTSW	1	163868722	missense	probably damaging	0.97
R9212:Kifap3	UTSW	1	163783031	missense	probably damaging	1.00
R9228:Kifap3	UTSW	1	163862097	missense	probably benign	0.11
R9350:Kifap3	UTSW	1	163783061	missense	probably benign	0.02
U24488:Kifap3	UTSW	1	163783035	missense	possibly damaging	0.64
Z1177:Kifap3	UTSW	1	163862062	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TACCATCCATCTGATAGCAATTCT -3'
(R):5'- TGCATACATCTATGAACATGCATATAG -3'

Sequencing Primer
(F):5'- AGCAATTCTGTCCATGAGAGCTG -3'
(R):5'- TGGATTAAGGAACCTACAGTAATCC -3'

Posted On

2020-06-30